pT7-gfap-sgRNA
(Plasmid
#65566)
-
Purposein vitro trancription of sgRNA targeting the zebrafish gfap locus
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePT7-sgRNA
- Total vector size (bp) 2829
-
Vector typein vitro RNA transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegfap sgRNA
-
gRNA/shRNA sequenceGTGCGCAACACATAGCACCA (reverse strand)
-
SpeciesD. rerio (zebrafish)
-
Entrez Genegfap (a.k.a. cb345, etID36982.3, gfapl, wu:fb34h11, wu:fk42c12, xx:af506734, zgc:110485)
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer M13pUC-fwd
- 3′ sequencing primer M13 Reverse
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-gfap-sgRNA was a gift from Jiu-lin Du (Addgene plasmid # 65566 ; http://n2t.net/addgene:65566 ; RRID:Addgene_65566) -
For your References section:
Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system. Li J, Zhang BB, Ren YG, Gu SY, Xiang YH, Huang C, Du JL. Cell Res. 2015 Apr 7. doi: 10.1038/cr.2015.43. 10.1038/cr.2015.43 PubMed 25849248