Skip to main content

pT7-gfap-sgRNA
(Plasmid #65566)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65566 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PT7-sgRNA
  • Total vector size (bp) 2829
  • Vector type
    in vitro RNA transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gfap sgRNA
  • gRNA/shRNA sequence
    GTGCGCAACACATAGCACCA (reverse strand)
  • Species
    D. rerio (zebrafish)
  • Entrez Gene
    gfap (a.k.a. cb345, etID36982.3, gfapl, wu:fb34h11, wu:fk42c12, xx:af506734, zgc:110485)
  • Promoter T7

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-gfap-sgRNA was a gift from Jiu-lin Du (Addgene plasmid # 65566 ; http://n2t.net/addgene:65566 ; RRID:Addgene_65566)
  • For your References section:

    Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system. Li J, Zhang BB, Ren YG, Gu SY, Xiang YH, Huang C, Du JL. Cell Res. 2015 Apr 7. doi: 10.1038/cr.2015.43. 10.1038/cr.2015.43 PubMed 25849248