-
PurposeAPEX2 fused to the C-terminus human vimentin
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66170 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepECFP
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 3970
- Total vector size (bp) 6163
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman Vimentin - APEX2
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2193
-
MutationAPEX2 contains 4 mutations relative to wt soybean APX: K14D, W41F, E112K, A134P
-
Entrez GeneVIM
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag epitope tag (DYKDDDDK) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CMVf (CGCAAATGGGCGGTAGGCGTG)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Vimentin - APEX2 in pECFP was a gift from Alice Ting (Addgene plasmid # 66170 ; http://n2t.net/addgene:66170 ; RRID:Addgene_66170) -
For your References section:
Directed evolution of APEX2 for electron microscopy and proximity labeling. Lam SS, Martell JD, Kamer KJ, Deerinck TJ, Ellisman MH, Mootha VK, Ting AY. Nat Methods. 2014 Nov 24. doi: 10.1038/nmeth.3179. 10.1038/nmeth.3179 PubMed 25419960