Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p5E-Runx1+23
(Plasmid #69602)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69602 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pENTR attL4-R1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4777
  • Total vector size (bp) 3415
  • Vector type
    5' Gateway Entry Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Runx1 +23 intronic enhancer
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    548
  • Entrez Gene
    Runx1 (a.k.a. AM, AML1, CBF-alpha-2, Cbfa, Cbfa2, Pebp, Pebp2a2, Pebpa2b)
  • Promoter C57/BL6 mouse Runx1 +23 intronic enhancer

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BglII (destroyed during cloning)
  • 5′ sequencing primer GGCTCGAGGGATCCGGGGTGGGAGGTGTAAGTTC
  • 3′ sequencing primer GGGCGGCCGCAGATCTCAGGTGTCAGCAACCCATC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Mouse beta-globin minimal promoter
  • Alt name
    Proximal promoter of Mus musculus hemoglobin, beta adult minor chain
  • Alt name
    Hbb-bt proximal promoter
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    131
  • GenBank ID
    NM_008220.5
  • Promoter C57/BL6 mouse beta-globin minimal promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer GGACTAGTCCAATCTGCTCAGAGAGGACA
  • 3′ sequencing primer GGCCGCGGGATGTCTGTTTCTGAGGTTGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid

Depositor Comments

All PCR was performed using the High Fidelity Advantage 2 PCR Kit (Clontech). The Runx1 +23 enhancer (1) was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (XhoI and BamHI sites added) 5’-GGCTCGAGGGATCCGGGGTGGGAGGTGTAAGTTC-3’ and Reverse (BglII and NotI sites added) 5’- GGGCGGCCGCAGATCTCAGGTGTCAGCAACCCATC -3’. The PCR fragment was gel purified, XhoI/BglII digested, ligated into XhoI/BamHI digested Tol2kit (2) #228 p5E-MCS vector and sequence verified. The mouse beta-globin minimal promoter was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (SpeI site added) 5’-GGACTAGTCCAATCTGCTCAGAGAGGACA-3’ and Reverse (SacII site added) 5’-GGCCGCGGGATGTCTGTTTCTGAGGTTGC-3’. The beta-globin minimal promoter and Runx1+23 5’ entry vector were SpeI/SacII digested and ligated together. Multisite Gateway reactions were performed according to the Invitrogen protocol.

1. Nottingham, W. T., Jarratt, A., Burgess, M., Speck, C. L., Cheng, J.-F., Prabhakar, S., et al. (2007). Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer. Blood, 110(13), 4188–4197. http://doi.org/10.1182/blood-2007-07-100883

2. Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E., Campbell, D. S., et al. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Developmental Dynamics : an Official Publication of the American Association of Anatomists, 236(11), 3088–3099. http://doi.org/10.1002/dvdy.21343

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p5E-Runx1+23 was a gift from Owen Tamplin & Leonard Zon (Addgene plasmid # 69602 ; http://n2t.net/addgene:69602 ; RRID:Addgene_69602)
  • For your References section:

    Hematopoietic stem cell arrival triggers dynamic remodeling of the perivascular niche. Tamplin OJ, Durand EM, Carr LA, Childs SJ, Hagedorn EJ, Li P, Yzaguirre AD, Speck NA, Zon LI. Cell. 2015 Jan 15;160(1-2):241-52. doi: 10.1016/j.cell.2014.12.032. 10.1016/j.cell.2014.12.032 PubMed 25594182