-
PurposeExpresses DREADDs Gq receptor under oxytocin promoter control
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70717 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5142
- Total vector size (bp) 7600
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehM3Dq-mCherry
-
Alt nameDREADDs-mCherry
-
SpeciesH. sapiens (human), Synthetic
- Promoter mouse oxytocin
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTTATGCTAGCGCCACCATG
- 3′ sequencing primer TTACTTGTACAGCTCGTCCATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid is derived as a modification from Addgene Plasmid #44361 - pAAV-hSyn-DIO-hM3D(Gq)-mCherry.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-mOXT-hM3Dq-mCherry-WPRE was a gift from Daniel Geschwind (Addgene plasmid # 70717 ; http://n2t.net/addgene:70717 ; RRID:Addgene_70717) -
For your References section:
Exogenous and evoked oxytocin restores social behavior in the Cntnap2 mouse model of autism. Penagarikano O, Lazaro MT, Lu XH, Gordon A, Dong H, Lam HA, Peles E, Maidment NT, Murphy NP, Yang XW, Golshani P, Geschwind DH. Sci Transl Med. 2015 Jan 21;7(271):271ra8. doi: 10.1126/scitranslmed.3010257. 10.1126/scitranslmed.3010257 PubMed 25609168