-
Purpose(Empty Backbone) for expression of gRNA in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepuc18
-
Vector typeBacterial Expression
- Promoter J231196
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer ACTAGTATTATACCTAGGACTGAGC
- 3′ sequencing primer GTTTTAGAGCTAGAAATAGCAAGTTAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Golden Gate cloning can be used to insert gRNAs.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGRB was a gift from Tao Chen (Addgene plasmid # 71539 ; http://n2t.net/addgene:71539 ; RRID:Addgene_71539) -
For your References section:
Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Li Y, Lin Z, Huang C, Zhang Y, Wang Z, Tang YJ, Chen T, Zhao X. Metab Eng. 2015 Sep;31:13-21. doi: 10.1016/j.ymben.2015.06.006. Epub 2015 Jun 30. 10.1016/j.ymben.2015.06.006 PubMed 26141150