pAL-pck_NT
(Plasmid
#74069)
-
PurposepAL374 plasmid carrying the pck (NT) sgRNA, targeting the non-template strand of pck, SpecR
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAL374
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA pck (NT)
-
gRNA/shRNA sequencepck (NT)
-
SpeciesSynthetic
- Promoter ptac
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCAGCCATCGGAAGCTGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAL-pck_NT was a gift from Timothy Lu (Addgene plasmid # 74069 ; http://n2t.net/addgene:74069 ; RRID:Addgene_74069) -
For your References section:
Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). Cleto S, Jensen JV, Wendisch VF, Lu TK. ACS Synth Biol. 2016 Feb 16. 10.1021/acssynbio.5b00216 PubMed 26829286
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/74/74069/74069-map_Kf2TlKc-WLq5.jpg.940x940_q85_autocrop.png)