Skip to main content

vGAT-pH pcaggs SE
(Plasmid #78578)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78578 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS E/S
  • Backbone size w/o insert (bp) 4790
  • Total vector size (bp) 7691
  • Modifications to backbone
    SphI site in the MCS removed because it contains an ATG
  • Vector type
    Mammalian Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    vGAT-pHluorin C-term
  • Alt name
    VGAT-pH
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3112
  • GenBank ID
    AF030253.1 AY533296.1
  • Entrez Gene
    Slc32a1 (a.k.a. Vgat, Viaat)
  • Promoter chicken actin
  • Tag / Fusion Protein
    • superecliptic pHluorin (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAGCTCGAGGTACCGATATC
  • 3′ sequencing primer CCTGAGGAGTGAATTGAGCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Original clone of rat VGAT was from Dr. Robert H. Edwards, University of California San Francisco
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    vGAT-pH pcaggs SE was a gift from Susan Voglmaier (Addgene plasmid # 78578 ; http://n2t.net/addgene:78578 ; RRID:Addgene_78578)
  • For your References section:

    Sorting of the vesicular GABA transporter to functional vesicle pools by an atypical dileucine-like motif. Santos MS, Park CK, Foss SM, Li H, Voglmaier SM. J Neurosci. 2013 Jun 26;33(26):10634-46. doi: 10.1523/JNEUROSCI.0329-13.2013. 10.1523/JNEUROSCI.0329-13.2013 PubMed 23804087