-
PurposeExpresses dCas9-VPR under Actin promoter for CRISPRa in Drosophila cell culture. Please note- this plasmid does not express GFP.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78898 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAWG
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-VPR
-
Insert Size (bp)5733
- Promoter pActin (Drosophila)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTGAACGCGACTTGAGAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydCas9-VPR cloned from PMID 25730490 into pActin vector for Drosophila cell culture expression
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAct:dCas9-VPR was a gift from Norbert Perrimon (Addgene plasmid # 78898 ; http://n2t.net/addgene:78898 ; RRID:Addgene_78898) -
For your References section:
Comparison of Cas9 activators in multiple species. Chavez A, Tuttle M, Pruitt BW, Ewen-Campen B, Chari R, Ter-Ovanesyan D, Haque SJ, Cecchi RJ, Kowal EJ, Buchthal J, Housden BE, Perrimon N, Collins JJ, Church G. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. 10.1038/nmeth.3871 PubMed 27214048