pX330-COSMC-KO
(Plasmid
#80008)
-
PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80008 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
- Backbone size w/o insert (bp) 8506
- Total vector size (bp) 8526
-
Modifications to backboneGuide RNA for COSMC gene cloned in BbsI restriction site
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCOSMC
-
gRNA/shRNA sequenceGAGTCTTTGGGCTGCAGTAA
-
SpeciesH. sapiens (human)
-
Entrez GeneC1GALT1C1 (a.k.a. C1GALT2, C38H2-L1, COSMC, HSPC067, MST143, TNPS)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCloning vector, pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230), was produced in Dr. Feng Zhang's lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-COSMC-KO was a gift from Sriram Neelamegham (Addgene plasmid # 80008 ; http://n2t.net/addgene:80008 ; RRID:Addgene_80008) -
For your References section:
Using CRISPR-Cas9 to quantify the contributions of O-glycans, N-glycans and Glycosphingolipids to human leukocyte-endothelium adhesion. Stolfa G, Mondal N, Zhu Y, Yu X, Buffone A Jr, Neelamegham S. Sci Rep. 2016 Jul 26;6:30392. doi: 10.1038/srep30392. 10.1038/srep30392 PubMed 27458028