pU6-Decoy
(Plasmid
#80324)
-
PurposeEncodes Cas9 and a CRISPR sgRNA that alleviates toxicity to Cas9 in Toxoplasma gondii
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80324 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepU6-Universal
- Backbone size w/o insert (bp) 8360
- Total vector size (bp) 8380
-
Modifications to backboneThe decoy protospacer has been cloned into the BsaI sites.
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDecoy sgRNA
-
gRNA/shRNA sequenceGAGAATGCAGTTTAGCACCGT
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCCATGGGATGAGACAAAG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-Decoy was a gift from Sebastian Lourido (Addgene plasmid # 80324 ; http://n2t.net/addgene:80324 ; RRID:Addgene_80324) -
For your References section:
A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Sidik SM, Huet D, Ganesan SM, Huynh MH, Wang T, Nasamu AS, Thiru P, Saeij JP, Carruthers VB, Niles JC, Lourido S. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2. 10.1016/j.cell.2016.08.019 PubMed 27594426