PB-TAC-OK+9MS
(Plasmid
#80482)
-
PurposepiggyBac transposon for dox-inducible expression of the OK+9MS (Oct4, Klf4[1-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80482 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 11404
-
Vector typeMammalian Expression ; piggyBac transposon
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOK+9MS
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)5115
-
MutationKlf4 [1-483]
-
Entrez GenePou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
-
Entrez GeneKlf4 (a.k.a. EZF, Gklf, Zie)
-
Entrez GeneMyc (a.k.a. Myc2, Niard, Nird, bHLHe39)
-
Entrez GeneSox2 (a.k.a. Sox-2, lcc, ysb)
- Promoter tetO
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCAAAAGACGGCAATATGGT
- 3′ sequencing primer GCTGTTTTGACCTCCATAGAAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Requires co-transfection with a piggyBac transposase plasmid for stable genomic integration. If you desire to use transposase with the Materials, you may contact Transposagen or other licensed vendor.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TAC-OK+9MS was a gift from Knut Woltjen (Addgene plasmid # 80482 ; http://n2t.net/addgene:80482 ; RRID:Addgene_80482) -
For your References section:
KLF4 N-terminal variance modulates induced reprogramming to pluripotency. Kim SI, Oceguera-Yanez F, Hirohata R, Linker S, Okita K, Yamada Y, Yamamoto T, Yamanaka S, Woltjen K. Stem Cell Reports. 2015 Apr 14;4(4):727-43. doi: 10.1016/j.stemcr.2015.02.004. Epub 2015 Mar 12. 10.1016/j.stemcr.2015.02.004 PubMed 25772473