Skip to main content

pDonor-tBFP-NLS-Neo (Universal)
(Plasmid #80767)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80767 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDonor-tBFP-NLS-Neo
  • Backbone manufacturer
    Kazuhisa Nakayama Lab. (Addgene plasmid #80766)
  • Backbone size w/o insert (bp) 4761
  • Total vector size (bp) 4763
  • Modifications to backbone
    A triplicated nuclear localization signal (NLS) was fused to tBFP. PITCh-gRNA#3 targeting sequence was inserted on upstream of the cytomegalovirus promoter.
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
  • Species
    Synthetic
  • Insert Size (bp)
    20

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer CACCTCTGACTTGAGCGTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDonor-tBFP-NLS-Neo (Universal) was a gift from Kazuhisa Nakayama (Addgene plasmid # 80767 ; http://n2t.net/addgene:80767 ; RRID:Addgene_80767)
  • For your References section:

    Practical method for targeted disruption of cilia-related genes by using CRISPR/Cas9-mediated homology-independent knock-in system. Katoh Y, Michisaka S, Nozaki S, Funabashi T, Hirano T, Takei R, Nakayama K. Mol Biol Cell. 2017 Feb 8. pii: mbc.E17-01-0051. doi: 10.1091/mbc.E17-01-0051. 10.1091/mbc.E17-01-0051 PubMed 28179459