-
PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80767 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDonor-tBFP-NLS-Neo
-
Backbone manufacturerKazuhisa Nakayama Lab. (Addgene plasmid #80766)
- Backbone size w/o insert (bp) 4761
- Total vector size (bp) 4763
-
Modifications to backboneA triplicated nuclear localization signal (NLS) was fused to tBFP. PITCh-gRNA#3 targeting sequence was inserted on upstream of the cytomegalovirus promoter.
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
-
SpeciesSynthetic
-
Insert Size (bp)20
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer CACCTCTGACTTGAGCGTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDonor-tBFP-NLS-Neo (Universal) was a gift from Kazuhisa Nakayama (Addgene plasmid # 80767 ; http://n2t.net/addgene:80767 ; RRID:Addgene_80767) -
For your References section:
Practical method for targeted disruption of cilia-related genes by using CRISPR/Cas9-mediated homology-independent knock-in system. Katoh Y, Michisaka S, Nozaki S, Funabashi T, Hirano T, Takei R, Nakayama K. Mol Biol Cell. 2017 Feb 8. pii: mbc.E17-01-0051. doi: 10.1091/mbc.E17-01-0051. 10.1091/mbc.E17-01-0051 PubMed 28179459