Skip to main content

N174-MCS
(Plasmid #81061)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 81061 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    N174
  • Backbone manufacturer
    Homemade
  • Backbone size (bp) 8861
  • Modifications to backbone
    Ligated an annealed oligo to introduce a multiple cloning site.
  • Vector type
    Mammalian Expression, Lentiviral
  • Promoter EF-1α
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
  • 3′ sequencing primer GTGGATGTGGAATGTGTGCGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N174-MCS was a gift from Adam Karpf (Addgene plasmid # 81061 ; http://n2t.net/addgene:81061 ; RRID:Addgene_81061)