mCyRFP1-Cdc42
(Plasmid
#84360)
-
Purposefusion protein of Cdc42, FRET donor
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEGFP-C1
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 5300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCyRFP1-Cdc42
-
SpeciesSynthetic
-
Insert Size (bp)1300
- Promoter CMV
-
Tag
/ Fusion Protein
- mCyRFP1 N terminal fusion to Cdc42
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcgtgtacggtgggaggtcta
- 3′ sequencing primer CTCTACAAATGTGGTATGGCT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCyRFP1-Cdc42 was a gift from Ryohei Yasuda (Addgene plasmid # 84360 ; http://n2t.net/addgene:84360 ; RRID:Addgene_84360) -
For your References section:
Simultaneous dual-color fluorescence lifetime imaging with novel red-shifted fluorescent proteins. Laviv T, Kim BB, Chu J, Lam AJ, Lin MZ, Yasuda R. Nat Methods. 2016 Oct 31. doi: 10.1038/nmeth.4046. 10.1038/nmeth.4046 PubMed 27798609