Skip to main content

pLV-hTERT-IRES-hygro
(Plasmid #85140)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85140 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV-EF1a-IRES-Hygro
  • Backbone size w/o insert (bp) 9211
  • Total vector size (bp) 12578
  • Vector type
    Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hTERT
  • Alt name
    TERT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3399
  • Entrez Gene
    TERT (a.k.a. CMM9, DKCA2, DKCB4, EST2, PFBMFT1, TCS1, TP2, TRT, hEST2, hTRT)
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer ACACCGGCCTTATTCCAA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pBABE-hygro-hTERT, Addgene plasmid #1773 (Counter CM, Hahn WC, Wei W, Caddle SD, Beijersbergen RL, Lansdorp PM, Sedivy JM, Weinberg RA. (1998) PNAS(25):14723-8. PMID: 9843956)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The 3rd generation packaging system (pMDLg/pRRE, pRSV-rev, and pVSVG) was used to create virus from this lentiviral transfer vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-hTERT-IRES-hygro was a gift from Tobias Meyer (Addgene plasmid # 85140 ; http://n2t.net/addgene:85140 ; RRID:Addgene_85140)
  • For your References section:

    Engulfed cadherin fingers are polarized junctional structures between collectively migrating endothelial cells. Hayer A, Shao L, Chung M, Joubert LM, Yang HW, Tsai FC, Bisaria A, Betzig E, Meyer T. Nat Cell Biol. 2016 Dec;18(12):1311-1323. doi: 10.1038/ncb3438. Epub 2016 Nov 14. 10.1038/ncb3438 PubMed 27842057