-
PurposeLentiviral expression of hTERT, used to create immortalized cell lines
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85140 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLV-EF1a-IRES-Hygro
- Backbone size w/o insert (bp) 9211
- Total vector size (bp) 12578
-
Vector typeLentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehTERT
-
Alt nameTERT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3399
-
Entrez GeneTERT (a.k.a. CMM9, DKCA2, DKCB4, EST2, PFBMFT1, TCS1, TP2, TRT, hEST2, hTRT)
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer ACACCGGCCTTATTCCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypBABE-hygro-hTERT, Addgene plasmid #1773 (Counter CM, Hahn WC, Wei W, Caddle SD, Beijersbergen RL, Lansdorp PM, Sedivy JM, Weinberg RA. (1998) PNAS(25):14723-8. PMID: 9843956)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The 3rd generation packaging system (pMDLg/pRRE, pRSV-rev, and pVSVG) was used to create virus from this lentiviral transfer vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-hTERT-IRES-hygro was a gift from Tobias Meyer (Addgene plasmid # 85140 ; http://n2t.net/addgene:85140 ; RRID:Addgene_85140) -
For your References section:
Engulfed cadherin fingers are polarized junctional structures between collectively migrating endothelial cells. Hayer A, Shao L, Chung M, Joubert LM, Yang HW, Tsai FC, Bisaria A, Betzig E, Meyer T. Nat Cell Biol. 2016 Dec;18(12):1311-1323. doi: 10.1038/ncb3438. Epub 2016 Nov 14. 10.1038/ncb3438 PubMed 27842057