-
PurposeExpresses TVA, EGFP, and optimized Rabies G (oG) protein in a FLEX cassette
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-syn-FLEX-splitTVA-eGFP-B19G IW
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameOptimized G Protein
-
Alt nameoG
-
SpeciesSynthetic
-
Insert Size (bp)1575
- Promoter hSyn
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer AGTCGTGTCGTGCCTGAGAG
- 3′ sequencing primer CGGGATCACTCTCGGCATGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEnhanced GFP
-
Alt nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
Gene/Insert 3
-
Gene/Insert nameTVA
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)468
-
Entrez GeneCD320 (a.k.a. TVA)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOptimized G protein was provide by Euiseok Kim and Ed Callaway at the Salk Institute.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-FLEX-TVA-P2A-EGFP-2A-oG was a gift from John Naughton (Addgene plasmid # 85225 ; http://n2t.net/addgene:85225 ; RRID:Addgene_85225)