|
|
48739 |
pET-UNC60A |
C. elegans UNC-60A cDNA (Caenorhabditis elegans)
|
Ono |
Oct 23, 2013 |
|
|
47458 |
LITE2.0 EF1a_TALE(Neurog2)-GS-CIB1(NLS*,∆318-334)_WPRE_hGHpA |
TALE (Neurog2)-GS-CIB1(NLS*,∆318-334) (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47453 |
LITE1.0_pAAV_hSyn_TALE(Grm2)-NLS-CIB1_2A_GFP_WPRE_bGHpA |
TALE (N136,Grm2,C63)-cib1 (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47452 |
pAAV_hSyn_TALEBB(NI)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpA |
TALE BB(N136_0.5NI_C63)-SID4X (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47451 |
pAAV_hSyn_TALEBB(NG)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpA |
TALE BB(N136_0.5NG_C63)-SID4X (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47449 |
pAAV_hSyn_TALEBB(NN)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpA |
TALE BB(N136_0.5NN_C63)-SID4X (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47447 |
pAAV_hSyn_TALEBB(NG)-NLS-VP64_2A_GFP_WPRE_bGHpA |
TALE BB(N136_0.5NG_C63)-VP64 (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47445 |
pAAV_hSyn_TALEBB(NN)-NLS-VP64_2A_GFP_WPRE_bGHpA |
TALE BB(N136_0.5NN_C63)-VP64 (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
48673 |
M-NM-sgRNA |
sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter (Synthetic)
|
Church |
Oct 22, 2013 |
|
|
48672 |
M-ST1-sgRNA |
sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter (Synthetic)
|
Church |
Oct 22, 2013 |
|
|
48679 |
M-tdTom-NM |
TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9 (Synthetic)
|
Church |
Oct 22, 2013 |
|
|
48678 |
M-tdTom-ST1 |
TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9 (Synthetic)
|
Church |
Oct 22, 2013 |
|
|
48677 |
M-tdTom-SP |
TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 (Synthetic)
|
Church |
Oct 22, 2013 |
|
|
48676 |
M-NMn-VP64 |
Cas9-VP64, nuclease-null (Other)
|
Church |
Oct 22, 2013 |
|
|
47978 |
pCAG-VSFP Butterfly 1.2 |
VSFP Butterfly 1.2 (Synthetic)
|
Knopfel |
Oct 22, 2013 |
|
|
42132 |
pQE-30-HyPer3 |
HYPER 3 (Synthetic)
|
Belousov |
Oct 22, 2013 |
|
|
47887 |
pNCMV 18E6no* delPDZ |
HPV 18 E6no* (Other)
|
Munger |
Oct 21, 2013 |
|
|
47866 |
pNCMV 18E6no* I130T |
HPV 18 E6no* (Other)
|
Munger |
Oct 21, 2013 |
|
|
47864 |
pNCMV 11E6 I127T |
HPV 11E6 (Other)
|
Munger |
Oct 21, 2013 |
|
|
47863 |
pNCMV 11E6 L111Q |
HPV 11E6 (Other)
|
Munger |
Oct 21, 2013 |
|
|
47862 |
pNCMV 6bE6 L129T |
HPV 6bE6 (Other)
|
Munger |
Oct 21, 2013 |
|
|
47861 |
pNCMV 6bE6 I127T |
HPV 6bE6 (Other)
|
Munger |
Oct 21, 2013 |
|
|
47800 |
pNCMV 6bE6 L111Q |
HPV 6bE6 (Other)
|
Munger |
Oct 21, 2013 |
|
|
47706 |
pNCMV 16E6no* I128T |
HPV 16 E6no* (Other)
|
Munger |
Oct 21, 2013 |
|
|
47705 |
pNCMV 16E6no* Y54D |
HPV 16 E6no* (Other)
|
Munger |
Oct 21, 2013 |
|
|
47678 |
pNCMV 16E6no* delPDZ |
HPV 16 E6no* (Homo sapiens)
|
Munger |
Oct 21, 2013 |
|
|
45931 |
pDZ513 (pHIS MET25pro PP7-PS-yeGFP) |
PCP-PS
|
Zenklusen |
Oct 21, 2013 |
|
|
48192 |
Flag-ATXN1_S602D_L686E |
Ataxin1 (Homo sapiens)
|
Zoghbi |
Oct 21, 2013 |
|
|
48136 |
pHBintE |
|
Jahn |
Oct 21, 2013 |
|
|
48133 |
pPK1E-1-gfp |
gfp
|
Jahn |
Oct 21, 2013 |
|
|
48132 |
pPK1E-2+t-gfp |
gfp
|
Jahn |
Oct 21, 2013 |
|
|
47667 |
Oncorhynchus kisutch cryaa |
Alpha A-crystallin (Other)
|
Posner |
Oct 21, 2013 |
|
|
47630 |
Danio rerio cryaa V62T |
Alpha A-crystallin (Danio rerio)
|
Posner |
Oct 21, 2013 |
|
|
48130 |
pPSP6+t-gfp |
gfp
|
Jahn |
Oct 21, 2013 |
|
|
48144 |
pK1E-RNAP |
rna polymerase K1E
|
Jahn |
Oct 21, 2013 |
|
|
48143 |
pSP6-RNAP |
rna polymerase SP6
|
Jahn |
Oct 21, 2013 |
|
|
48116 |
pRBBm69 |
promoter sacB - sacB
|
Jahn |
Oct 21, 2013 |
|
|
38170 |
Phi80 JQ929581 |
mKate2 (Synthetic), Superfolder GFP (Synthetic)
|
Endy |
Oct 21, 2013 |
|
|
44948 |
pFA6a-link-yoPS-CFP2-Kan |
yoPS-CFP2 (Synthetic)
|
Thorn |
Oct 18, 2013 |
|
|
44943 |
pFA6a-link-yoLSS-mKate2-Kan |
yoLSS-mKate2 (Synthetic)
|
Thorn |
Oct 18, 2013 |
|
|
44906 |
pFA6a-link-yoTagRFP-T-Kan |
yoTagRFP-T (Synthetic)
|
Thorn |
Oct 18, 2013 |
|
|
48721 |
pTYB1-pLAC-V69S |
Lacritin (Homo sapiens)
|
Laurie |
Oct 18, 2013 |
|
|
44955 |
pFA6a-link-yoTagRFP657-Kan |
yoTagRFP657 (Synthetic)
|
Thorn |
Oct 17, 2013 |
|
|
48656 |
PM-TD!TB |
Bacterial TD crRNA to prototspacer B (Synthetic)
|
Church |
Oct 17, 2013 |
|
|
48652 |
PM-NM!TB |
Bacterial NM crRNA to prototspacer B (Synthetic)
|
Church |
Oct 17, 2013 |
|
|
48872 |
pJSM103 |
split lacZ
|
Glickman |
Oct 17, 2013 |
|
|
47944 |
pMB62 |
Cas9 (Synthetic)
|
Boxem |
Oct 17, 2013 |
|
|
48663 |
SK-YFP-TD-B |
TD prototspacer B/PAM with reporter EYFP (Synthetic)
|
Church |
Oct 17, 2013 |
|
|
48664 |
SK-YFP-NM-A |
NM prototspacer A/PAM with reporter EYFP (Synthetic)
|
Church |
Oct 17, 2013 |
|
|
48364 |
pDS66 |
3XHA-intergenic region of TUB-HYG (modified from PMID 16269191) (Other)
|
Cross |
Oct 17, 2013 |
