We narrowed to 45,571 results for: Ina
-
Plasmid#124813PurposeHighly resposive GFP-based pyruvate nanosensor to explore mitochondrial metabolism.DepositorInsertPyronicSF
TagsMitochondrial Sequence SignalExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDsRed Monomer C1-YAP2-S127A mutant
Plasmid#19058DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsRed-FPPExpressionMammalianMutationSerine 127 changed to AlanineAvailable SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
His-Precission-NEDD4L_C942S_pCDNA3.1(+)
Plasmid#187729PurposeExpress the catalytically inactive NEDD4L FL in mammalian cellsDepositorInsertNEDD4L FL with C874 mutated to a serine (NEDD4L Human)
TagsHis-HRV 3C siteExpressionMammalianMutationCys874 mutated to a serineAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
NLS-PyronicSF/pCMV-myc-nuc
Plasmid#124814PurposeHighly resposive GFP-based pyruvate nanosensor with a nuclear localization signal.DepositorInsertPyronicSF
TagsNuclear Localization SignalExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP1-S127A
Plasmid#18988DepositorInsertYes-kinase associated protein S127A mutant (YAP1 Human)
TagsHisExpressionMammalianMutationSerine 127 changed to Alanine, mutated protein t…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-CRY2-CreN
Plasmid#26888PurposeExpresses N-terminal fragment of Cre fused to CRY2 for blue light-induced activation of DNA recombination when used with CIBN-CreC. Also expresses mCherry.DepositorExpressionMammalianMutationaa 19-104 of CrePromoterCMVAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 WT KSR1
Plasmid#25970DepositorAvailable SinceAug. 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
p2xFlag CMV2-YAP2-1st WW mutant
Plasmid#19046DepositorInsertYes-kinase associated protein isoform 3 (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 199 changed to Alanine,and Proline 202…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
p2xFlag CMV2-YAP2-2nd WW mutant
Plasmid#19047DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 258 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAGIG-H2B-V5-mScarlet
Plasmid#191093PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertH2B and mScarlet
UseAAVTagsH2B-V5-mScarletExpressionMammalianMutationThe fusion protein was optimized to the Human cod…PromoterCMV and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2xFlag CMV2 Lats1-PY1+2 mutant
Plasmid#18975DepositorInsertLarge tumor suppressor kinase 1 PY1+2 mutant (LATS1 Human)
Tags2xFlagExpressionMammalianMutationPY1 mutant, (Tyrosine 376 changed to Alanine) and…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCSCRET2(#323)
Plasmid#184058Purposecyclofen-inducible CRE activation via mammalian cell transfection or mRNA synthesisDepositorInsert6myc-CRE-ERT2
UseSynthetic BiologyTags6xMycExpressionMammalianMutationERT2: G400V, M543A, L544A, deleted 1-281;PromotersCMV+SP6Available SinceJuly 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PLK4-K41M-S285A-T289A-3xFLAG
Plasmid#69842PurposeThis plasmid encodes kinase dead PLK4 isoform 1 carrying K41M and S285A/T289A mutations with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorInsertPLK4 (PLK4 Human)
Tags3xFLAG tag and EGFPExpressionMammalianMutationK41M-S285A-T289APromoterCMVAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-GST-Nter-GWs-Lox (VE5586)
Plasmid#163766PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter GST tag under the pH promoter.DepositorInsertN-terminal GST tag
TagsGST TagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-6His-Nter-GWs-Lox (VE5587)
Plasmid#163768PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter 6 His tag under the pH promoter.DepositorInsertN-terminal 6His tag
Tags6 His TagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-10His-Cter (VE5631)
Plasmid#161802PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter10His tag under the p10 promoter.DepositorInsertC-terminal 10 His tag
Tags10 HisExpressionInsectPromoterp10Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-P10-mCherry-pH-3C-TwinStrep (VE5621)
Plasmid#139770PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter TwinStrep tag under the PH promoter.DepositorInsertC-terminal TwinStrep tag
Tags3C - TwinStrep tagPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-p10-10His-Cter (VE5742)
Plasmid#139776PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter10His tag under the pH promoter.DepositorInsertC-terminal 10His tag
Tags10 HisExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-p10-Flag-Cter(VE5738)
Plasmid#161798PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter Flag tag under the p10 promoter.DepositorInsertC-terminal Flag tag
TagsFlagExpressionInsectPromoterp10Available SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-10His-Nter-GWs-Lox (VE5588)
Plasmid#161806PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter 10 His tag under the pH promoter.DepositorInsertN-terminal 10His tag
Tags10 HisExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-1st WW mutant
Plasmid#18998DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 199 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-2nd WW mutant
Plasmid#18999DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 258 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 N539
Plasmid#25972DepositorInsertKinase suppressor of Ras 1 (Ksr1 Mouse)
TagsFlagExpressionMammalianMutationDeleted amino acids 540-873Available SinceAug. 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 C540
Plasmid#25971DepositorInsertKinase suppressor of Ras 1 (Ksr1 Mouse)
TagsFlagExpressionMammalianMutationDeletes amino acids 1-539Available SinceAug. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Yes-SH2-AviTag
Plasmid#214208PurposeBacterial expression of SH2 domain of the Yes kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertYes kinase SH2 domain (YES1 Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-DIO-ExRai-AKAR2-T/A
Plasmid#171847PurposeCre-dependent, synapsin promoter-driven expression of the negative control phosphomutant ExRai-AKAR2 T/A PKA biosensor in neurons.DepositorInsertExRai-AKAR2 T/A
UseAAVExpressionMammalianMutationT6A phospho-deficient mutationPromoterhSyn1Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-NEDD4L_FL-CS
Plasmid#187713PurposeExpress the catalytically inactive GST-tagged NEDD4L FL in bacterial cellsDepositorInsertNEDD4L FL with C874 mutated to a serine (NEDD4L Human)
TagsGST-HRV 3C siteExpressionBacterialMutationCys874 mutated to a serineAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 D122A pcDNA3
Plasmid#206068Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1DepositorAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT22iU66CriT(#387)
Plasmid#184061Purposecyclofen-inducible CRE activation in zebrafish permanent transgenicDepositorInsertCRE-ERT2
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only