We narrowed to 18,203 results for: Uty

#105017

Lentiviral gRNA plasmid targeting mouse Kcmf1 , co-expression of TagBFP

Kosuke Yusa

Li et al Cell Rep. 2018 Jul 10;24(2):489-502. doi

Sept. 4, 2019

Academic Institutions and Nonprofits only

#105858

Expression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutatnions modify charge of CH2 domain.

Joanna Bereta

Klaus et al Front Immunol. 2018 May 23;9:1096. doi:

March 20, 2018

Academic Institutions and Nonprofits only

#85210

TRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

Oct. 4, 2017

Academic Institutions and Nonprofits only

#82428

Plasmid for expression of GST-tagged C-terminal region of Nematostella vectensis GW182 11W11A (aa 1159-1698) in mammalian cells

Marina Chekulaeva

Mauri et al Nucleic Acids Res. 2016 Sep 6. pii: gkw7

Oct. 31, 2016

Academic Institutions and Nonprofits only

#82429

Plasmid for expression of NHA-tagged C-terminal region of Nematostella vectensis GW182 11W11A (aa 1159-1698) in mammalian cells

Marina Chekulaeva

Mauri et al Nucleic Acids Res. 2016 Sep 6. pii: gkw7

Oct. 31, 2016

Academic Institutions and Nonprofits only

#203965

Dox inducible FLAG tag ARID1a in a sleeping beauty transposon construct

Elaine Fuchs

Yang et al Nat Cell Biol. 2023 Jul 24. doi: 10.1038

Jan. 16, 2025

Academic Institutions and Nonprofits only

#105315

Photoconvertable cytoskeletal protein actin to study kinetics or dynamics

Kenneth Yamada

Doyle et al J Cell Sci. 2012 May 1;125(Pt 9):2244-56

Feb. 22, 2018

Academic Institutions and Nonprofits only

#236769

A sleeping beauty-based vector containing CAG promoter-driven mCherry-P2A-EIF3D-IRES-Pac.

Kazutoshi Takahashi

Okubo et al Sci Adv. 2025 Apr 11;11(15):eadq5484. do

May 21, 2025

Academic Institutions and Nonprofits only