We narrowed to 14,740 results for: Ung;
-
Plasmid#253019PurposeA MoClo YTK Type 3 part GFP dropout vector to assemble a signal peptide and protein of interest as N-terminal fusion with 2xFLAG-SED1 display anchor in a URA3, CEN6/ARS4 yeast expression plasmidDepositorInsertGFP
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD053
Plasmid#252966PurposeEncodes S. cerevisiae 2xFLAG-Tag-Aga2-linker as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD088
Plasmid#252978PurposeEncodes 2xFLAG-Tagged S. cerevisiae Aga2p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit for N-terminal fusionDepositorInsertFLAG-tagged Aga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD291
Plasmid#253024PurposeEncodes the S. cerevisiae Aga1 protein (Part3) with pPGK1 promoter, tENO2 terminator, KanamycinR yeast selectable marker and CEN/ARS yeast originDepositorInsertAGA1
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD292
Plasmid#253025PurposeEncodes the S. cerevisiae Aga1 protein (Part3) with pPGK1 promoter, tENO2 terminator, HygromycinR yeast selectable marker and CEN/ARS yeast originDepositorInsertAGA1
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD293
Plasmid#253026PurposeEncodes the S. cerevisiae Aga1 protein (Part3) with ppPGK1 promoter, tENO2 terminator, ZeocinR yeast selectable marker and CEN/ARS yeast originDepositorInsertAGA1
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD862
Plasmid#253015PurposeEncodes Anti-mCherryLaM-4 Nanobody as a Type 3b' part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertAnti-mCherry_LaM-4 Nanobody
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD861
Plasmid#253014PurposeEncodes Anti-ALFA-tag Nanobody as a Type 3b' part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertAnti-ALFA-tag Nanobody
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD288
Plasmid#253023PurposeEncodes the S. cerevisiae Aga1 protein (Part3) with pGAL1 inducible promoter, tENO2 terminator, KanamycinR yeast selectable marker and CEN/ARS yeast originDepositorInsertAGA1
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD052
Plasmid#252965PurposeEncodes S. cerevisiae HA Tag-Aga2-linker as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD058
Plasmid#252971PurposeEncodes S. cerevisiae MYC Tag-Aga2-linker as a Type 3a part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD069
Plasmid#252973PurposeEncodes Anti-GFP Nanobody (no tag) as a Type 3b' part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertAnti-GFP Nanobody
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD047
Plasmid#252963PurposeEncodes S. cerevisiae Pir2 anchor-linker-MYC Tag as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertPir
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD051
Plasmid#252964PurposeEncodes S. cerevisiae Aga2-(NoTag)-linker as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD094
Plasmid#252984PurposeEncodes GFP11-M3-His6-tag as a Type 4a part to be used for fluoresence complementation based detection in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertGFP11-M3-His6-tag
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD046
Plasmid#252962PurposeEncodes S. cerevisiae Pir anchor-linker-2xFLAG Tag as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertPir
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pIN3 (gpdA-cTerm-Citrine2-ptrA)
Plasmid#188737PurposeExpresses Citrine2 for C-terminal taggingDepositorInsertgdpA-Citrine2 PtrA
UseFilamentous fungal expressionTagsCitrine2Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIN4 (gpdA-nTerm-Citrine2-ptrA)
Plasmid#188738PurposeExpresses Citrine2 for N-terminal taggingDepositorInsertgdpA-Citrine2 PtrA
UseFilamentous fungal expressionTagsCitrine2Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIN5 (gpdA-cTerm-mTurqoise2-ptrA)
Plasmid#188739PurposeExpresses mTurqoise2 for C-terminal taggingDepositorInsertgdpA-mTurquoise PtrA
UseFilamentous fungal expressionTagsmTurquoiseAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIN6 (gpdA-nTerm-mTurqoise2-ptrA)
Plasmid#188740PurposeExpresses mTurqoise2 for N-terminal taggingDepositorInsertgdpA-mTurqoise2 PtrA
UseFilamentous fungal expressionTagsmGreenlanternAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-mVenusC-14-HP1b Chromo W42A
Plasmid#191399PurposeW42A binding pocket mutant of HP1b chromo domain fused to C-terminal part of split mVenusDepositorInsertFLAG-mVenusC-14-HP1b Chromo W42A
Tags3xFLAGExpressionMammalianMutationW42APromoterCMVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
BPK880-pCAG-DmrC-NLS-3xFLAG-VP64
Plasmid#136912PurposeDmrC with VP64 fused to it's C-terminus; Mammalian expression vectorDepositorInsertpCAG-DmrC-NLS-3xFLAG-VP64
UseCRISPRExpressionMammalianPromoterChicken Beta ActinAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-147
Plasmid#136020PurposeEIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-464
Plasmid#136021PurposeEIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552
Plasmid#136022PurposeEIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-464
Plasmid#136023PurposeEIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-552
Plasmid#136024PurposeEIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Unstructured
Plasmid#136026PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-Unstructured-EIF3B
Plasmid#136027PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only