We narrowed to 3,540 results for: cgas
-
Plasmid#198726PurposeCas9-mediated knockout of RhoC in mammalian cells #3DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-2O-crBFP_EF1a-BFP
Plasmid#224783PurposeBFP-targeting crRNA for RfxCas13d expressed from hU6-2xTetO promoter and target BFP protein expressed from EF1a promoterDepositorInsertcrBFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-E690_guide-CBh-hSpCas9
Plasmid#188545PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid E690DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_131
Plasmid#216095PurposeCas12a [EnAs] CRISPRa targeting CD97, CD4, CD26, CD274, positive controlDepositorInsertCD97, CD4, CD26, CD274 guides
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgNT-3_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211695PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgNT-3 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgNT-2_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211694PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgNT-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgVRK2-puro
Plasmid#199636PurposesgRNA guide against VRK2DepositorInsertN/A (VRK2 Human)
UseLentiviralAvailable SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgLacZ-puro
Plasmid#199635PurposesgRNA control guide targeting bacterial LacZDepositorInsertN/A
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
tet pLKO.1-shCse1l v1 puro
Plasmid#192342PurposeLentiviral expression vector for an inducible shCse1L v1DepositorInsertshCse1l v1 (Cse1l Budding Yeast)
UseLentiviralAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mNudcd3 - 2
Plasmid#198502Purposelentiviral stable expression of mNudcd3 gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mRab12-2
Plasmid#198476Purposelentiviral stable expression of mRab12 gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shPP1C #2
Plasmid#198763Purposeconditional knockdown of PP1CDepositorInsertshPP1C #2 (PPP1CC Human)
ExpressionMammalianAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgGPAA1 guide 2
Plasmid#193609PurposeGPAA1 knockoutDepositorInsertsgGPAA1 guide 2 (GPAA1 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC9
Plasmid#193176PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: TCGAAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-PB-SRT-tdTomato_BC7
Plasmid#193172PurposeBarcoded piggyBac self-reporting transposon with tdTomato marker in AAV backboneDepositorInsertBarcoded piggyBac tdTomato SRT
UseAAVMutationBarcode: CGATAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-SRT-Puro_BC9
Plasmid#193151PurposeBarcoded piggyBac self-reporting transposon with puromycin marker for mammalian calling cardsDepositorInsertBarcoded piggyBac Puro SRT
ExpressionMammalianMutationBarcode: TCGAAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-SRT-Puro_BC6
Plasmid#193148PurposeBarcoded piggyBac self-reporting transposon with puromycin marker for mammalian calling cardsDepositorInsertBarcoded piggyBac Puro SRT
ExpressionMammalianMutationBarcode: CGATAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only