We narrowed to 12,047 results for: shRNA
-
Plasmid#65819PurposegltA-udhA targeting guide RNA array E. coli , Low Phosphate InductionDepositorInsertgltA2-udhA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induc…Available SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRDB_248
Plasmid#245335PurposeCas12a CRISPRko positive control guide; targets CD63DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgVamp2
Plasmid#159920PurposeMutagenesis of Vamp2DepositorInsertVamp2 (Vamp2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro
Plasmid#28289Purpose3rd generation lentiviral plasmid; This plasmid is the backbone for the DECIPHER libraries (currently DISCONTINUED)DepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianAvailable SinceApril 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
PX458_ATF4_2
Plasmid#72352PurposeEncodes gRNA for 3' target of human ATF4 along with Cas9 with 2A GFPDepositorInsertATF4 (ATF4 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_ATF4_1
Plasmid#72351PurposeEncodes gRNA for 3' target of human ATF4 along with Cas9 with 2A GFPDepositorInsertATF4 (ATF4 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX458-AAVS1-sg
Plasmid#194721Purposepx458 with guide RNA that target hAAVS1DepositorArticleAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hGSDMD
Plasmid#185377PurposeFor mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D)DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMTF1.1.0-gDNA
Plasmid#113797PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MTF1DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-TMPRSS2-A6
Plasmid#188690PurposesgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAIO-Ef1a-PE2-GFP:KCNQ2-C201R
Plasmid#185060PurposeEf1a driven PE2 plasmid with pegRNA for editing C201R mutation in KCNQ2 gene. See Addgene plasmid #184445DepositorInsertU6:pegRNA:scaffold:PBS+RT template
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_mouse_Adar1_ccB
Plasmid#158122Purposedeletion mAdar1DepositorInsertAdar1 (Adar Mouse)
ExpressionMammalianAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_mouse_Adar1_ccA
Plasmid#158120Purposedeletion mAdar1DepositorInsertAdar1 (Adar Mouse)
ExpressionMammalianAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pResQ shFEN3 3XF-FEN1 wt
Plasmid#17752DepositorInsertFlap Endonuclease I (FEN1 Human)
UseLentiviral and RNAiTagsTriple FlagExpressionMammalianAvailable SinceApril 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hMYC
Plasmid#185376PurposeFor mammalian expression of guide RNA: TGCTGCCAAGAGGGTCAAGT that targets human MYCDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pX459-puro-hPKAalpha
Plasmid#185379PurposeFor mammalian expression of guide RNA: caccgTTTGAACGAATCAAGACCCT that targets human PKA subunit alphaDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330_SMAD exon 2 gRNA
Plasmid#68350Purposepx330 with gRNA towards SMAD exon 2. Cas9 is expressed from a CAG promoter.DepositorInsertSMAD exon 2 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_DNMT3B
Plasmid#72366PurposeEncodes gRNA for 3' target of human DNMT3B along with Cas9 with 2A GFPDepositorInsertDNMT3B (DNMT3B Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
px330_P53 exon 8 gRNA
Plasmid#68349Purposepx330 with gRNA towards P53 exon 8. Cas9 is expressed from a CAG promoter.DepositorInsertP53 exon 8 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only