We narrowed to 3,004 results for: PHI-1
-
Plasmid#158491PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 without STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationno STOP codonAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJFRC7-JEDI-1P
Plasmid#202618PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P under the promoter hsp70 for Drosophila (insect) expressionDepositorInsertJEDI-1P
ExpressionInsectPromoterhsp70Available SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZA5
Plasmid#158483PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 with STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationSTOP codonAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_spatzle-HA
Plasmid#240227PurposeGateway entry clone with spatzle tagged with HA (contains stop codon)DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA1
Plasmid#186663PurposeNbr C-tag sgRNA1 plasmidDepositorInsertNbr sgRNA 1 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
p28-2iDP-puro
Plasmid#88893PurposeDual-intron DMD platform plasmid. Co-expresses DMD platform segment, firefly luciferase, puroR and mCherry. Plasmid carries phiC31 and Bxb1 attB sites.DepositorInsertsDual-intron DMD platform
luciferase
puromycin resistance enzyme
mCherry
ExpressionMammalianMutationTruncated version of the dystrophin protein (tran…Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pEB2-mNeptune2.5
Plasmid#104013PurposePlasmid encoding mNeptune2.5DepositorInsertmNeptune2.5
UseLow copyExpressionBacterialMutationMutations relative to eqFP578 (MSKGEE LIKENM… M11…PromoterproCAvailable SinceDec. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB1-moxCerulean3
Plasmid#103975PurposePlasmid encoding moxCerulean3DepositorInsertmoxCerulean3
UseLow copyExpressionBacterialMutationMutations relative to wild-type GFP (F64L, Y66W, …PromoterproCAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPerimCh
Plasmid#227013PurposeExpresses periplasmic mCherryDepositorInsertPelB-mCherry, arabinose inducible cytosolic GFP
ExpressionBacterialPromoterrpsM and pBADAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
DAXX-myc-his
Plasmid#1852DepositorAvailable SinceMay 4, 2005AvailabilityAcademic Institutions and Nonprofits only -
pZA8
Plasmid#158486PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 L17E/D481V with STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationL17E, D481V, STOP codonAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mNeptune2
Plasmid#104012PurposePlasmid encoding mNeptune2DepositorInsertmNeptune2
UseLow copyExpressionBacterialMutationMutations relative to eqFP578 (MSKGEE LIKENM… R32…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mRFP1*
Plasmid#104000PurposePlasmid encoding mRFP1*DepositorInsertmRFP1*
UseLow copyExpressionBacterialMutationMutations relative to DsRed (MSKGEE NNLAVIKEF...T…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mRFP1
Plasmid#104001PurposePlasmid encoding mRFP1DepositorInsertmRFP1
UseLow copyExpressionBacterialMutationMutations relative to DsRed (R2A, K5E, N6D, T21S,…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZA7
Plasmid#158485PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 L17E with STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationL17E, STOP codonAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA15
Plasmid#158493PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 L17E without STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationL17E, no STOP codonAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA6
Plasmid#158484PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 D481V with STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationD481V, STOP codonAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only