We narrowed to 9,935 results for: SIM
-
Plasmid#28234DepositorInsertl(3)mbt-like 1 (Drosophila) (L3MBTL1 Human)
UseTagsHisExpressionBacterialMutationTruncation expressing only aa 252-606 (MBT repeat…PromoterAvailable sinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1puro-shKIBRA-A
Plasmid#40888DepositorInsertshKIBRA-A (WWC1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1puro-shKIBRA-B
Plasmid#40889DepositorInsertshKIBRA-B (WWC1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceNov. 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
USPQ-HTT-TALEN1
Plasmid#92243PurposeTALEN targeting upstream of HTT gene (KKR), forms obligate heterodimer with USPQ-HTT-TALEN2DepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCMVAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
USPQ-HTT-TALEN2
Plasmid#92244PurposeTALEN targeting upstream of HTT gene (ELD), forms obligate heterodimer with USPQ-HTT-TALEN1DepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCMVAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
DSPQ-HTT-TALEN2 BSD
Plasmid#92246PurposeTALEN targeting downstream of HTT gene (ELD) with Blasticidin selection, forms obligate heterodimer with DSPQ-HTT-TALEN1 ZEO. TALEN: NN, HD, NN, NN, HD, NG, NN, NI, NN, NN, HD, NI, NN, HD, NI, NNDepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCAGAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
DSPQ-HTT-TALEN1 ZEO
Plasmid#92245PurposeTALEN targeting downstream of HTT gene (KKR) with Blasticidin selection, forms obligate heterodimer with DSPQ-HTT-TALEN2 BSD. TALEN: HD, NI, NN, HD, NG, NG, HD, HD, NG, HD, NI, NN, HD, HD, NN, HDDepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCAGAvailable sinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-somBiPOLES-mCerulean (AAV Retrograde)
Viral Prep#154948-AAVrgPurposeReady-to-use AAV Retrograde particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA. CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIa(0.4)TagsmCeruleanAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean (AAV Retrograde)
Viral Prep#154951-AAVrgPurposeReady-to-use AAV Retrograde particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn-somBiPOLES-mCerulean
Plasmid#154945PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianMutationPromoterhuman synapsinAvailable sinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn-BiPOLES-mCerulean
Plasmid#154944PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertBiPOLES
UseAAVTagsExpressionMammalianMutationPromoterhuman synapsinAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean
Plasmid#154951PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorHas ServiceAAV Retrograde, AAV5, and AAV9InsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianMutationPromoterhuman synapsinAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-somBiPOLES-mCerulean
Plasmid#154948PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorHas ServiceAAV Retrograde, AAV5, and AAV9InsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianMutationPromoterCaMKIIa(0.4)Available sinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ef1a-DIO-BiPOLES-mCerulean
Plasmid#154949PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertBiPOLES
UseAAVTagsExpressionMammalianMutationPromoterEf1-alphaAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-BiPOLES-mCerulean
Plasmid#154950PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertBiPOLES
UseAAVTagsExpressionMammalianMutationPromoterhuman synapsinAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJOP-HTT-HR18Q
Plasmid#87228PurposeHTT HR arms with 18 CAG repeats and piggyBac selection cassetteDepositorInsert1.7kb HTT 5' homology arm, 2.5kb HTT 3' homology arm
UseTagsExpressionMammalianMutationPromoterEF1a driving selection cassetteAvailable sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
mDlx-BiPOLES-mCerulean
Plasmid#154946PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertBiPOLES
UseAAVTagsExpressionMammalianMutationPromoterminimal DlxAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only