-
Plasmid#127520PurposePlasmid has an inverted CaMV 35S promoter sequence (reverse complement) flanked by attB and attP attachment sites of integrases 2, 4, and 5. EGFP coding sequence is in the forward orientation.DepositorInsertCaMV 35S reverse complement promoter sequence flanked by attB/attP Integrase 2, 4 and 5 attachment sites.
UseTagsExpressionPlantMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET21a HsDHFR-bio-10His
Plasmid#193883PurposeExpresses human dihydrofolate reductase (DHFR) with C-terminal AviTag (Bio) and His10 sequenceDepositorInserthuman dihydrofolate reductase (DHFR) (DHFR Human)
UseTagsHis tag and biotinylation sequenceExpressionBacterialMutationCodon optimizedPromoterT7Available sinceOct. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-Quartet_NoLinker
Plasmid#214731PurposeIn mammalian cells expresses a Quartet of receptor-binding domains (RBDs) from the sarbecoviruses SHC014, Rs4081, RaTG13, and SARS-CoV-2 with no linkers between the RBDs and an N-terminal SpyTagDepositorInsertSpyTag-Quartet_NoLinker (S Synthetic)
UseTagsSpyTagExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-Cx26G45E-IRES-GCaMP6s
Plasmid#188237Purpose3rd generation, inducible bicistronic lentiviral plasmid for expression of human connexin 26 variant p.G45E and GCaMP6sDepositorInsertGJB2 (GJB2 Human)
UseLentiviralTagsExpressionMammalianMutationp.G45EPromoterTight TRE promoterAvailable sinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMECP2-RFP
Plasmid#181905PurposeFluorescently tagged MECP2, RFPDepositorInsertMECP2 (Mecp2 Mouse)
UseTagsRFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-2R-2K+3D
Plasmid#178680PurposeBacterial expression of N-terminally 6His tagged A1-LCD with two Arg residues removed, two Lys removed, three Asp added (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-2R+2K+3D (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationtwo Arg residues removed, two Lys added, three As…PromoterAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD+7K+12D
Plasmid#178679PurposeBacterial expression of N-terminally 6His tagged A1-LCD with seven Lys residues added, twelve Glu residues added (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD+7K+12D (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationseven Lys residues added, twelve Glu residues add…PromoterAvailable sinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-4R-2K+5D
Plasmid#178681PurposeBacterial expression of N-terminally 6His tagged A1-LCD with four Arg residues removed, two Lys removed, five Asp added (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-4R+2K+5D (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationfour Arg residues removed, two Lys added, five As…PromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD+7R+10D
Plasmid#178677PurposeBacterial expression of N-terminally 6His tagged A1-LCD with seven Arg residues added, ten Glu residues added (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD+7R+10D (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationseven Arg residues added, ten Glu residues addedPromoterAvailable sinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-mHP1beta
Plasmid#181901PurposeFluorescently tagged HP1betaDepositorInsertmHP1beta (Cbx1 Mouse)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-EGFP-GPI-stop-L2
Plasmid#186355PurposeEntry clone with ORF encoding plasma membrane-targeted EGFP-GPI fusion protein flanked by Gateway recombination sequencesDepositorInsertsignal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site (CD59 Human, Synthetic)
UseExpression of a fluorescent membrane markerTagsEGFPExpressionMutationPromoterAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry]
Plasmid#197599PurposePan-neuronal expression of SNG-1::CRY2(D387A)olig(535) in neurons of C. elegans. CRY2(D387A) is photoinactiveDepositorUseTagsExpressionWormMutationD387A, E490GPromoterAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
UseTagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PGL-1-mHP1alpha
Plasmid#181899PurposeFluorescently tagged HP1alpha fused to PGL-1DepositorInsertPGL-1-mHP1alpha (Cbx5 Nematode, Mouse)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-30G+30S-12F+12Y
Plasmid#178687PurposeBacterial expression of N-terminally 6His tagged A1-LCD with thirty Gly residues replaced with Ser, twelve Phe residues replaced with Tyr (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-30G+30S-12F+12Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationthirty Gly residues replaced with Ser, twelve Phe…PromoterAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-30G+30S+7F-7Y
Plasmid#178686PurposeBacterial expression of N-terminally 6His tagged A1-LCD with thirty Gly residues replaced with Ser, seven Tyr residues replaced with Phe (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-30G+30S+7F-7Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationthirty Gly residues replaced with Ser, seven Tyr …PromoterAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-20G+20S+7F-7Y
Plasmid#178688PurposeBacterial expression of N-terminally 6His tagged A1-LCD with twenty Gly residues replaced with Ser, seven Tyr residues replaced with Phe (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-20G+20S+7F-7Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationtwenty Gly residues replaced with Ser, seven Tyr …PromoterAvailable sinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-14N-4Q+18G
Plasmid#178694PurposeBacterial expression of N-terminally 6His tagged A1-LCD with fourteen Gln residues removed, four Asn removed, replaced with eighteen Gly (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-14N-4Q+18G (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationfourteen Gln residues removed, four Asn removed, …PromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only