We narrowed to 11,097 results for: CHL
-
Plasmid#231501PurposeExpressing HRP on the cell surface under CAG promoterDepositorInsertHRP
UseAAVTagsIgk, HA, Myc, PDGFR-beta transmembrane domainExpressionMammalianPromoterCAGAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSET_SynPspA
Plasmid#223812PurposeBacterial expression of SynPspA with N-terminal 10xHis-tag and EK cleavage siteDepositorInsertSynPspA
Tags10xHis and NusAExpressionBacterialAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT006
Plasmid#225157PurposeLow copy cloning vector for integration of C-terminal FLAG epitope tag (ChlR). SmaI restriction site immediately upstream of the FLAG epitope. FLAG epitope in opposite orientation of lac promoter.DepositorTypeEmpty backboneUseSynthetic BiologyTagsFLAG epitope tag (35 bp)ExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT005
Plasmid#225156PurposeLow copy cloning vector for integration of C-terminal FLAG epitope tag (ChlR). SmaI restriction site immediately upstream of the FLAG epitope. FLAG epitope in same orientation as lac promoter.DepositorTypeEmpty backboneUseSynthetic BiologyTagsFLAG epitope tag (35 bp)ExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJET-PgpdA
Plasmid#213466PurposeVector containing the gpdA promoter for Golden Gate cloning in the Fg vectorDepositorInsertPromoter of the glyceraldehyde-3-phosphate dehydrogenase
ExpressionBacterialAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBA326
Plasmid#214743PurposeHigh copy glmS-nadE plasmid containing chloramphenicol as antibiotic resistance gene (ARG) for validationDepositorInsertBBa_J23108-RBS(8455)-glmS-RBS(5392)-nadE
ExpressionBacterialAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSV014
Plasmid#214740PurposeHigh copy thyA-infA plasmid containing chloramphenicol as antibiotic resistance gene (ARG) for validationDepositorInsertBBa_J23108-RBS(7504)-thyA-RBS(4427)-infA
ExpressionBacterialAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEG302-JMJ14-ZF
Plasmid#200913PurposeExpress JMJ14-ZF108 in Arabidopsis target FWA geneDepositorInsertJMJ14
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-HD2A-ZF
Plasmid#200915PurposeExpress HD2A-ZF108 in Arabidopsis target FWA geneDepositorInsertHD2A
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHYX173
Plasmid#202817PurposePlasmid expressing the TEV protease, codon-optimized for Saccharomyces cerevisiae.DepositorInsertTEV protease
ExpressionYeastPromoterScPCK1Available SinceNov. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-UnaG-FLAG
Plasmid#203479PurposeFor Agrobacterium transformation. A plastid transit peptide fused UnaG-FLAG under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertPlastid transit peptide fused UnaG-FLAG
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-tagRFP
Plasmid#203482PurposeFor Agrobacterium transformation. tagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertTagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag.
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-HO1(51-231)
Plasmid#203486PurposeFor recombinant protein production in Escherichia coli. His-tagged Arabidopsis thaliana HEME OXYGENASE 1 (HO1) without the plastid transit peptide under the control of the T7 promoter.DepositorInsertArabidopsis thaliana HEME OXYGENASE1 (51 aa – 231 aa)
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB560-NADK2
Plasmid#203760PurposeFor Agrobacterium transformation. tagRFP fused Arabidopsis thaliana NAD KINASE2 (NADK2) under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertNAD KINASE2
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Talin-T48-L432G-Cterminal-mEmerald
Plasmid#202373PurposeTalin(DeltaR2-10)-L432G-mEmeraldDepositorInsertTalin(DeltaR2-10)-L432G-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Talin-T58-L432G-Cterminal-mEmerald
Plasmid#202372PurposeTalin(DeltaR4-10)-L432G-mEmeraldDepositorInsertTalin(DeltaR4-10)-L432G-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Talin-T100-L432G-Cterminal-mEmerald
Plasmid#202371PurposeTalin(FullLength)-L432G-mEmeraldDepositorInsertTalin(FullLength)-L432G-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Talin-T46-L432G-Cterminal-mEmerald
Plasmid#202374PurposeTalin(DeltaR4-12)-L432G-mEmeraldDepositorInsertTalin(DeltaR4-12)-L432G-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A-AtUBI10-dCas9-24XGP41
Plasmid#202011PurposeMoclo level 1 - Module A, Promoter: AtUBI10, Gene: dCas9-24XGP41, Terminator: HSPDepositorInsertdCas9-24XGP41
UseSynthetic Biology; Moclo level 1 vectorPromoterAtUBI10Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only