We narrowed to 30,517 results for: ide
-
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorInserthu Mcl-1.1 (MCL1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterH1tAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#2)
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorInsertCRBN (CRBN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pInducer-FRA1
Plasmid#192267PurposeDoxycycline-inducible expression of murine FRA1 (Fosl1)DepositorInsertFosl1 (Fosl1 Mouse)
UseLentiviral; Inducible expressionTagsExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*leu*
Plasmid#21173DepositorInsertDUX4 (DUX4 Human)
UseTagsExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…PromoterAvailable sinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV_S5E2_Chrimson_tdTomato
Plasmid#219432PurposeAAV construct expressing Chrimson-tdTomato under the control of E2 regulatory elementDepositorInsertChrimson-tdTomato
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX_305-N-dTAG-FRA1
Plasmid#188742Purposeexpresses murine Fosl1 (Fra1) with N-terminal tag FKBP F36V (dTAG) for the dTAG systemDepositorInsertFosl1 (Fosl1 Mouse)
UseLentiviralTagsFKBP F36V tag (dTAG)ExpressionMammalianMutationPromoterhPGK promoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7vB4
Plasmid#113073PurposePlasmid for highly efficient expression of engineered IL24 with binding affinity to cognate receptorsDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 Human, SUMO part (Brachypodium distachyon))
UseTagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7
Plasmid#113072PurposePlasmid for highly efficient expression of engineered IL24 with mutated binding sitesDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 Human, SUMO part (Brachypodium distachyon))
UseTagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDF_AtRaf1/Raf2/RbcX2/BSD2/RbcX1
Plasmid#229510PurposeExpresses Arabidopsis thaliana chaperones: Raf1,Raf2,RbcX2,BSD2,RbcX1DepositorInsertsUseTagsExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available sinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-dTom-nlsdTom
Plasmid#135630PurposeAAV vector to drive the expression of dTomato in PV cortical interneurons under the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertdTom-nlsdTom
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GFP-fGFP
Plasmid#135631PurposeAAV vector to drive the expression of fGFP in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGFP-fGFP
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GCaMP6f
Plasmid#135632PurposeAAV vector to drive the expression of GCaMP6f in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGCaMP6f
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-Gq-P2A-dTomato
Plasmid#135635PurposeAAV vector to drive the expression of Gq-DREADD-P2A-dTomato in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGq-P2A-dTomato
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-ChR2-mCherry
Plasmid#135634PurposeAAV vector to drive the expression of ChR2-mCherry in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertChR2-mCherry
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E6-dTom-nlsdTom
Plasmid#135641PurposeAAV vector to drive the expression of dTomato in VIP cortical interneurons under the control of the E6 regulatory elementDepositorHas ServiceAAV1InsertdTom-nlsdTom
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-C1V1-eYFP
Plasmid#135633PurposeAAV vector to drive the expression of C1V1-eYFP in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, AAV5, and AAV9InsertC1V1-eYFP
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28 His-MBP-TEV-BAP-Human BCKDK
Plasmid#232116PurposeFor bacterial expression of Human BCKDK (AA31–412, missing precursor peptide) with an N-terminal biotin acceptor peptide and a cleavable His-MBP purification tag.DepositorInsertBCKDK (BCKDK Human)
UseTags6 x His, Biotin acceptor peptide (BAP), Maltose-B…ExpressionBacterialMutationPromoterT7 PromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E29-ChR2GFP2x
Plasmid#153437PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E29 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVTagsExpressionMutationPromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E5-dTom-nlsdTom
Plasmid#135640PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E5 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only