We narrowed to 27,080 results for: invs
-
Plasmid#177867PurposeCloning Backbone for Blasticidin-S-deaminase-based EXSISERS containing FRT-sites flanked PuroR cassetteDepositorInsertBSD-based EXSISERS
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsOLLASExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_SurfaceHaloTag_FRT-PuroR
Plasmid#177869PurposeCloning Backbone for Surface-HaloTag-based EXSISERS containing FRT-sites flanked PuroR cassette; clone homology arms via BbsI (or BpiI).DepositorInsertSurface-HaloTag-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C N-terminal deletion C-terminus replaced NBCe C-terminus (NT94)
Plasmid#50912PurposeExpresses human NKCC1 with truncation of N-terminus, mutations at P676C I730C and C-terminus replaced with that of NBCe. Contains an N-terminal 3xFLAG-YFP tag for expression in mammalian cellsDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationP676C and I730C; N-term deletion of aa13-222; C-t…PromoterCMVAvailable SinceFeb. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N-terminus T,S mutations P676C I730C (NT95)
Plasmid#50913PurposeExpresses human NKCC1 with mutated Ser and Thr residues in the N-terminus and mutations at P676C I730C. Contains N-terminal 3xFLAG-YFP tag for expression in mammalian cellsDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationS150N S155Q S170Q T177A S183R S193E T203A T205A T…PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSIN-TRE-H2BeGFP-rtTA2
Plasmid#165494PurposeDoxycycline-inducible all-in-one lentivirus vector to express H2BeGFP fusion protein. System for labelling slow-cycling cells in vivo.DepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 human PP2A Aα full length
Plasmid#132634Purposeexpresses human PP2A Aα full length in E. coliDepositorInsertPP2A Aα (PPP2R1A Human)
ExpressionBacterialAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Jaws-KGC-GFP-ER2]
Plasmid#108274PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterEF1α promoter (1.1kb short version)Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_mGreenLantern_FRT-PuroR-HSV-TK
Plasmid#177868PurposeCloning Backbone for mGreenLantern-based EXSISERS containing FRT-sites flanked PuroR-HSV-TK cassette; clone homology arms via BbsI (or BpiI).DepositorInsertmGreenLantern-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsOLLASExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
retro-gfpIkkb-puro vector
Plasmid#58251PurposeRetroviral expression vector encoding bicistronic EGFP-IKKbeta and Puromycin cassetteDepositorAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEF2-EFGR-hMer
Plasmid#225996PurposeExpresses a chimeric construct having N-terminal human EGFR and C-terminal human MerTKDepositorExpressionMammalianPromoterEF1-aAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLXSN p110 CUX1
Plasmid#90471PurposeRetroviral vector expressing human p110 CUX1 (amino acids 747-1505) with a Myc and HA tag at the N- and C-terminue, respectivelyDepositorInsertCUX1 (amino acids 747-1505) (CUX1 Human)
UseRetroviralTagsHA and MycExpressionMammalianPromoterMoloney murine leukemia virus long terminal repeatAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 human PP2A B56α full length
Plasmid#132635Purposeexpresses human PP2A B56α full length in E. coliDepositorInsertPP2A B56α
ExpressionBacterialAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.1
Plasmid#222473PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 1). Variant 1 is chr10:128568698-A-G where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 1) (LOC110120928 Human)
UseLuciferaseMutationVariant 1 is chr10:128568698-A-G where the inform…Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-PB2_Lock1-I436C+S993C
Plasmid#182879PurposeLentivirus for expression of Plexin-B2 locked ring mutantDepositorInserthPLXNB2 (PLXNB2 Human)
UseLentiviralMutationchanged Isoleucine 436 to Cysteine and Serine 993…Available SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-PB2_Lock2-I436C+T1051C
Plasmid#182880PurposeLentivirus for expression of Plexin-B2 locked ring mutantDepositorInserthPLXNB2 (PLXNB2 Human)
UseLentiviralMutationchanged Isoleucine 436 to Cysteine and Threonine …Available SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF2-EFGR-hTyro
Plasmid#225998PurposeExpresses a chimeric construct having N-terminal human EGFR and C-terminal human Tyro3DepositorExpressionMammalianPromoterEF1-aAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF2-EFGR-hAxl
Plasmid#225997PurposeExpresses a chimeric contruct having N-terminal human EGFR and C-terminal human AxlDepositorExpressionMammalianPromoterEF1-aAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.3
Plasmid#222475PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 3). Variant 3 is chr10:128569437-G-A where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 3) (LOC110120928 Human)
UseLuciferaseMutationVariant 3 is chr10:128569437-G-A where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only