We narrowed to 4,788 results for: Drosophila
-
Plasmid#112974PurposeFor protein expression and purification of full-length Drosophila pngDepositorAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only
-
GFP-fly Arp11
Plasmid#51399Purposeexpression of full-length Drosophila Arp11 in mammalian cellsDepositorAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
CapChR2_pUAST-attb
Plasmid#188041PurposeExpresses CapChR2 in DrosophilaDepositorInsertCapChR2
TagsnoneExpressionInsectMutationS43D, L112C, T139C and N238E mutations in CoChRPromoterUASAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGex4t2 with full-length SUUR
Plasmid#112990PurposeExpresses fusion of GST and full-length Drosophila SUURDepositorInsertSuUR (SuUR Fly)
ExpressionBacterialAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral FL
Plasmid#113012PurposeFor bacterial expression of MBP fusion of full-length Drosophila Tral WTDepositorInsertfull length tral (tral Fly)
ExpressionBacterialAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAct:MCP-VP64
Plasmid#78904PurposeExpresses MCP:VP64 under actin promoter for "Scaffold" CRISPRa in Drosophila cellsDepositorInsertMS2:VP64
UseCRISPRExpressionInsectPromoterpActin (Drosophila)Available SinceMarch 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
act5C-mScarlet
Plasmid#230906PurposeUbiquitous expression of mScarlet in Drosophila melanogasterDepositorInsertmScarlet
ExpressionInsectPromoteract5CAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
OA-986F (AAEL003877-dCas9-VPR)
Plasmid#183993PurposeExpresses dCas9-VPR under the Ae. aegypti polyubiquitin promoterDepositorInsertAAEL003877-dCAS9-VPR
UseCRISPRTagsdCas9-VPRExpressionInsectPromoterAAEL003887Available SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p10xUAS-IVS- Syn21-Voltron-p10
Plasmid#119041PurposeUAS-driven expresion of Voltron in DrosophilaDepositorInsertVoltron
ExpressionInsectPromoterhsp70Available SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
20XUAS IVS ChrimsonR mCherry_tr
Plasmid#111546PurposeOptogenetics in Drosophila: UAS-induced expression of ChrimsonR mCherryDepositorInsertChrimsonR_mCherry_trafficked
ExpressionInsectMutationwtPromoterhsp70Available SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT7R-7xsfGFP11-HA-HDR-donor
Plasmid#221818PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT7R coding frameDepositorInsert7xGFP11-HA donor with 5-HT7R homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT7R-sfGFP11-HA-CRISPR-HDR-donor
Plasmid#221819PurposeDonor plasmid for inserting GFP11-HA to the end of Drosophila 5-HT7R coding frameDepositorInsertGFP11-HA donor with homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only