We narrowed to 7,159 results for: GFP expression plasmids
-
Plasmid#115783PurposeThis plasmid encodes for Sox10-MCS5-GFP reporter. Cell carrying this construct expresses green fluorescence under the control of SOX-MCS5 enhancer conjugated with cfos basal promoter.DepositorInsertmouse derived SOX10 Multiple Species Conserved enhancer element 5 conjugated with cfos basal promoter
UseLentiviralTagscfos basal promoter conjugated MCS5 promoter fuse…PromoterSOX10 Multiple Species Conserved enhancer element…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
TrHKII-pGFPN3
Plasmid#21921DepositorInsertTruncated human HKII cDNA (lacking the sequence encoded by exon 1, which is the mitochondrial binding domain) in pGFP-N3 plasmid (HK2 Human)
TagsGFPExpressionMammalianMutationThis is the truncated human HKII cDNA sequence (l…Available SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
fgfprom luc
Plasmid#69446Purposebasal plasmid containing minimal fgf4 promoter used for testing enhancer activity of DNAs inserted immediately upstream of the promoter.DepositorInsertminimal fgf4 promoter
UseLuciferaseExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-eArchT3.0-P2A-EGFP-WPRE-hGHpA
Plasmid#51110PurposeForebrain principal neuron expression of eArchT3,0 with physically uncoupled EGFP fluorophoreDepositorInserteArchT3.0
UseAAVTagsP2A-EGFPExpressionMammalianPromoterCaMKIIaAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-EGFP-WPRE-pA
Plasmid#37084PurposeCre-dependent expression of EGFPDepositorInsertEGFP
UseAAV and Cre/Lox; Cre-onPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJEP224-AAV-Basic-0.4αCaMKII-GFP-pA
Plasmid#62909PurposeAAV basic vector backbone designed to express GFP from a 0.4CaMKIIa promoter. It also contains a poly-Adenylation Signal (pA).DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoter0.4αCaMKIIAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hPDGFRA-GFP
Plasmid#22919DepositorInserthuman platelet derived growth factor receptor alpha polypeptide promoter driving GFP (PDGFRA Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLEGFP-Y705F-STAT3
Plasmid#71445PurposeRetroviral expression of Y705F-STAT3. Please note that this plasmid contains Y705F-STAT3 tagged with FLAG, not GFP.DepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-GFP(39TAG)
Plasmid#217360PurposeExpression of reporter EGFP with a TAG stop codon at 39 aa position; can be packaged into bacmidDepositorInsertEnhanced green fluorescent protein
UseBaculoviralExpressionInsect and MammalianMutationY39TAGPromoterCMVAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
CD8a-cNLS-EGFP
Plasmid#86052PurposeA mammalian expression plasmid expressing CD8a luminal and transmembrane domains followed by cNLS (classical nuclear localization signal) and C-terminus EGFP.DepositorInsertCD8a (CD8A Human)
TagsGFPExpressionMammalianMutationCD8a luminal and transmembrane along with two SV4…PromoterCMVAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAML141F,Y115F:5HT3HC-IRES-GFP
Plasmid#32477PurposeCre-dependent expression of PSAM-5HT3 HC (L141F,Y115F) neuronal activator, with IRES-EGFP markerDepositorInsertPSAML141F,Y115F-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceJan. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAMQ79G,Q139G:5HT3HC-IRES-GFP
Plasmid#32475PurposeCre-dependent expression of PSAM-5HT3 HC (Q79G,Q139G) neuronal activator, with IRES-EGFP markerDepositorInsertPSAMQ79G,Q139G-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceDec. 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pmGFP-ADAR1-p150
Plasmid#117927PurposeADAR1-p150 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Cre
Plasmid#86805PurposeLentiviral vector that expresses an EGFP-Cre fusion protein with a nuclear localization signal from the CMV promoterDepositorInsertCre recombinase
UseCre/Lox and LentiviralTagsEGFP and nuclear localization signal: PKKKRKVExpressionMammalianPromoterCMVAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmGFP-ADAR1-p110
Plasmid#117928PurposeADAR1-p110 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CXCL12-sfGFP
Plasmid#98961PurposeMammalian expression plasmid for superfolder GFP-fused human chemokine CXCL12DepositorInsertCXCL12 (CXCL12 Human)
TagsSuperfolder GFPExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
SP6-VEE-GFP
Plasmid#58976Purposeexpression of GFP using a self-replicating Venezuelan equine encephalitis (VEE) virus RNA repliconDepositorInsertEGFP
UseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianPromoter26S subgenomic promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SV40.eGFP.SV40(polyA)
Plasmid#195558PurposeExpresses eGFP under control of short GFAP promoterDepositorInserteGFP
UseAAVTagsNo tagsExpressionMammalianPromotershort GFAPAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only