168,037 results
-
Plasmid#117123PurposeC-terminal GFP tagDepositorInsertSuperfolder GFP
UseGolden gate donor vector for gene targeting in ba…TagssfGFPAvailable SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
ABE8.20-SpRY
Plasmid#226859PurposeExpresses ABE8.20-SpRY base editor in mammalian cells with eGFP markerDepositorInsertABE8.20-SpRY
ExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJ1458 (pFA6-link-mTurquoise2-CaURA3MX)
Plasmid#86424PurposePCR tagging module with yeast codon optimized mTurquoise2DepositorInsertmTurquoise2
ExpressionYeastAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
HsB2AR-mCherry
Plasmid#137785PurposeVisualization of the Beta-2-adrenergic receptorDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK 14-3-3 sigma GST
Plasmid#11944DepositorAvailable SinceMay 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-BRLF1(Rta)
Plasmid#195824PurposeGateway Entry Clone of Epstein-Barr virus BRLF1DepositorInsertBRLF1 (BRLF1 Epstein-Barr virus)
UseGateway entry vectorAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAUX_OL
Plasmid#166246Purposeuse as an auxiliary temperature-sensitive plasmid to successfully transform pdCas9_CL plasmidDepositorInsert[P112-sgRNA-term]-[J23116_B34-dCas9-B15]
ExpressionBacterialPromoterEc-TTL-P112 and BBa_J23116Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-eCas9-sgNT
Plasmid#140238PurposeLentiviral vector expressing high-specificity eSpCas9(1.1) and a control non-targeting sgRNADepositorInsertnon-targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-FLAG PHGDH
Plasmid#212995Purposeexpresses human PHGDHDepositorAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF2932
Plasmid#144408PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
6x-His_A1aY1_GFP
Plasmid#158753PurposeBacterial expression of 6xHis-A1aY1 fused with carboxy terminus GFP for recombinant purificationDepositorInsert6xHistidine_A1aY1_GFP
Tags6x-Histidine tag, GFP, T7 leader sequence, and Th…ExpressionBacterialPromoterT7Available SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hs.NRAS Q61R
Plasmid#83179PurposeGateway ORF Entry clone of human NRAS [NM_002524.4 ] with stop codon (for native or N-terminal fusions), Q61R mutationDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
ITPR1_Halo_N_allele
Plasmid#178161PurposeDonor vector for endogenous tagging of human ITPR1 at the N-terminus with halotagInsertHalotag (ITPR1 Human)
UseDonor vectorAvailable SinceDec. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Gluc-RMA-IRES-EGFP
Plasmid#189629PurposeExpresses Gluc-RMA and EGFP under the hSyn promoter. Gluc-RMA for monitoring neuronal transduction.DepositorInsertsGaussia luciferase fused to Fc
IRES-EGFP
UseAAV and LuciferaseTagsGluc and IgG1 FcExpressionMammalianPromoterIRES and hSynAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO-SPOTlight-U2GCR
Plasmid#231889PurposeCre-dependent reporter to measure ISR state-dependent protein synthesisDepositorInsertDIO-SPOTlight-U2GCR
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
E. coli K-12 MG1655_rLP5(nth-ydgR)
Bacterial Strain#110245PurposeE. coli K-12 MG1655 with Landing Pad engineered into the nth-ydgR intergenic region. The Landing Pad consists of floxed mCherry,Chlor that are cotranscribed.DepositorBacterial ResistanceChloramphenicolAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJK511
Plasmid#155384PurposedCas12a oscillator, reverse direction crRNAs. dCas12a (D917A) + PA4-mVenusDepositorInsertsdCas12a (F. novicida)
PA4-mVenus
dCas12a oscillator crRNAs
UseCRISPRExpressionBacterialMutationD917A (nuclease-deactivating)Available SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
RP156 pUAST EGFP:Gr21a
Plasmid#59524PurposeN-terminal fusion of EGFP to Drosophila melanogaster Gr21aDepositorAvailable SinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-hSyn1-GFP
Plasmid#177810PurposeEncodes a GFP driven by human synapsin I promoterDepositorInsertCopGFP inserted behind human synapsin I promoter (SYN1 Human)
UseLentiviralExpressionMammalianPromoterSyn1Available SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only