We narrowed to 4,082 results for: Gaa
-
Plasmid#241457PurposeDelete TMEM173 (STING)DepositorAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only
-
NSE-huCof K22Q + rat cof shRNA
Plasmid#245962PurposeSilencing of endogenous cofilin in rat/mouse neurons with replacment by neuronal specific expression of K22Q mutant of human cofilinDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationK22QPromoterNSE for cofilin K22Q and pol III for shRNAAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ33-lenti-U6-Oct4-PE-acti-gRNA-DsRed
Plasmid#131076PurposeActivation of Mafa via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_SKIV2L2 (pAVA3251)
Plasmid#239323PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting SKIV2L2DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting SKIV2L2 (MTREX Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_ZCRB1 (pAVA3300)
Plasmid#239325PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNA stargeting ZCRB1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting ZCRB1 (ZCRB1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPKR_2g)-PGKpuro2AmCherry-W
Plasmid#208435PurposeLentiviral gRNA plasmid targeting human PKR gene, co-expression of mCherry tagDepositorInsertPKR (EIF2AK2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U9Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_1k)-PGKpuro2ABFP-W
Plasmid#208429PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_2b)-PGKpuro2ABFP-W
Plasmid#208430PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-Fgf5Pro
Plasmid#227479Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-36kb-USF
Plasmid#227463Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-36kb-USF
Plasmid#227464Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterhuman U6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-Rb1shRNA1
Plasmid#220584PurposeTo inducibly knockdown Rb1 expressionDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF649_5-1)-PGKpuroBFP-W
Plasmid#212000PurposeExpress gRNA against ZNF649 with puro and BFPDepositorInsertsgRNA targeting ZNF649 (ZNF649 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NANOG_g2)-PGKpuroBFP-W
Plasmid#211975PurposeExpress gRNA against NANOG with puro and BFPDepositorInsertsgRNA targeting NANOG (NANOG Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETS2_5-5)-PGKpuroBFP-W
Plasmid#211959PurposeExpress gRNA against ETS2 with puro and BFPDepositorInsertsgRNA targeting ETS2 (ETS2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETS2_5-2)-PGKpuroBFP-W
Plasmid#211958PurposeExpress gRNA against ETS2 with puro and BFPDepositorInsertsgRNA targeting ETS2 (ETS2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPV-C1-crRNA(DMD#20_DMD#23)-EF1a-BA
Plasmid#204620PurposeExpression vector of crRNA (DMD#20) targeting the dystrophin intron 44 just upstream of exon 45, and crRNA(DMD#23)targeting the dystrophin intron 55 just downstream of exon 55. Blasticidin selectable.DepositorInsertcrRNA#20 (targeting DMD intron44) and crRNA#23 (targeting DMD intron 55)
UseCRISPRPromoterU6Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS13-Tps2/Gsy1
Plasmid#196613PurposeEncoding guide RNAs for the knock out of TPS2 and GSY1 genesDepositorAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-1 lentiCRISPR v2 plasmid
Plasmid#192231Purposelentiviral vector expressing sgRNA-1 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-1 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-whiteCopyCatcher
Plasmid#174062PurposeCopyCatcher insertion donor for the white locusDepositorInsertwhite (w Synthetic, Fly)
ExpressionBacterialAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-Exoc7-Ex5&10
Plasmid#133303PurposeEGFP reporter sequence was removed from TLCV2 vector and two gRNAs targeting mouse Exoc7 gene were cloned into the modified TLCV2 vector.DepositorInsertExocyst complex component 7 (Exoc7 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromotermU6 promoterAvailable SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1388 - pAAV MANF gRNA A+B EF1a EGFP
Plasmid#113157PurposeAn AAV vector that expresses guide RNAs targeting rat MANF and expresses EGFP reporterDepositorInsertTwo gRNAs for rat MANF
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
rd
Plasmid#112912PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tagDepositorInsertdematin (DMTN Human)
TagsGlutatione-S-Tranferase and precision protease si…ExpressionBacterialMutationPEST sequence near the N-terminal removed. 5′-GCG…PromoterT7Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
PHKA2 gRNA (BRDN0001146244)
Plasmid#77842Purpose3rd generation lentiviral gRNA plasmid targeting human PHKA2DepositorAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMK2B gRNA (BRDN0001148102)
Plasmid#77742Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2BDepositorAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
BRSK2 gRNA (BRDN0001146828)
Plasmid#78025Purpose3rd generation lentiviral gRNA plasmid targeting human BRSK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only