We narrowed to 3,237 results for: sam
-
Plasmid#131462PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic H3F3A K27M, PDGFRA D842V, and TRP53DepositorInsertH3F3A-K27M-EGFP AU1 pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationH3F3A K27M, Pdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor-H3F3A-WT-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
Plasmid#131461PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of WT H3F3A and oncogenic PDGFRA D842V and TRP53DepositorInsertH3F3A-WT-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationPdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)
Plasmid#217340PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor-H3F3A-G34R-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
Plasmid#131463PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic H3F3A G34R, PDGFRA D842V, and TRP53DepositorInsertH3F3A-G34R-EGFP AU1 pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationH3F3A G34R, Pdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available SinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR/XBB.1.5
Plasmid#212993PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.5 with with furin side intactDepositorInsertSpike S-RRAR/XBB.1.5 (S )
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); furin site intake; (T19I…PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor TagBFP2-V5-HRAS G12VWPRE
Plasmid#129420PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic Hras G12V with a TagBFP2 fusionDepositorInsertTagBFP2-V5-HRAS G12V (HRAS Entacmaea quadricolor (TagBFP), Human)
UseMosaic analysis for dual recombinase-mediated cas…TagsTagBFP2-V5 tagMutationG12VPromoternone (3x polyA to mitigate episomal expression)Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B-p58 G579S
Plasmid#239216PurposeExpresses CDK11B p58 isoform with G579S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B p58 isoform with G579S resistance mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 579 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B D562A, G579S
Plasmid#239218PurposeExpresses CDK11B with D562A kinase inactivating mutation and G579S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B with D562A kinase inactivating mutation and G579S resistance mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Aspartic acid 562 to Alanine and changed …Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5D HA-PPM1H_M flap
Plasmid#236718PurposeExpresses PPM1H with PPM1M flap domain sequenceDepositorArticleTagsHAExpressionMammalianMutationPPM1H flap domain replaced with PPM1M flap domainPromoterCMVAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5D HA-PPM1M_H flap
Plasmid#236719PurposeExpresses PPM1M with PPM1H flap domain sequenceDepositorArticleTagsHAExpressionMammalianMutationPPM1M flap domain replaced with PPM1H flap domainPromoterCMVAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor TagBFP2-V5-HRAS G12V WPRE RCE
Plasmid#131730PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic Hras G12V with a TagBFP2 fusion compatible with RCE:loxP mouse strainDepositorInsertTagBFP2-V5-HRAS G12V (HRAS Entacmaea quadricolor (TagBFP), Human)
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTagBFP2-V5 tagExpressionMammalianMutationG12VPromoternone (4x polyA to mitigate episomal expression)Available SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V1 (Concentrated Lentiviral Prep)
Viral Prep#115643-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V1 (#115643). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V1 plasmid DNA. <p><p>Ready-to-use lentiviral particles carrying version 1 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.</p></p>DepositorPromoterMinimal CMVTagsEGFPAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V3 (Concentrated Lentiviral Prep)
Viral Prep#115645-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V3 (#115645). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V3 plasmid DNA. Ready-to-use lentiviral particles carrying version 3 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.DepositorPromoterMinimal CMVTagsEGFPAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V2 (Concentrated Lentiviral Prep)
Viral Prep#115644-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V2 (#115644). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V2 plasmid DNA. Ready-to-use lentiviral particles carrying version 2 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.DepositorPromoterMinimal CMVTagsEGFPAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTR01F/hFGFR2c-V5
Plasmid#236013Purposefor PiggyBac mediated integration and stable expression of hFGFR2c proteinDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTR01F/hFGFR2b-V5
Plasmid#236014Purposefor PiggyBac mediated integration and stable expression of hFGFR2b proteinDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FGFR1-Fc(DAPA)-AviTag-6xHis
Plasmid#156800PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFGFR1 (FGFR1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTR01F/hFGFR1b-V5
Plasmid#236012Purposefor PiggyBac mediated integration and stable expression of hFGFR1b proteinDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only