We narrowed to 11,272 results for: cat.1

#229507

Expresses Anthoceros agrestis chaperones: Raf1,Raf2,RbcX2,BSD2

Laura Gunn

Oh et al Mol Plant. 2024 Dec 2;17(12):1833-1849.

June 20, 2025

Academic Institutions and Nonprofits only

#229508

Expresses Anthoceros agrestis chaperones: Raf1,Raf2,RbcX1,BSD2

Laura Gunn

Oh et al Mol Plant. 2024 Dec 2;17(12):1833-1849.

June 20, 2025

Academic Institutions and Nonprofits only

#142897

Lentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.

Feng Zhang

Joung et al Cell. 2023 Jan 5;186(1):209-229.e26. doi

March 28, 2024

Academic Institutions and Nonprofits only

#249121

expression of gIl1r1 and mCherry

Matthew Krummel

Kuhn et al J Exp Med. 2026 May 4;223(5):e20251228.

March 4, 2026

Academic Institutions and Nonprofits only

#193234

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Ros1 gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 12, 2022

Academic Institutions and Nonprofits only

#26406

Elizabeth Fisher

Stevens et al PLoS One. 2010 . 5(3):e9541.

Nov. 8, 2010

Academic Institutions and Nonprofits only

#26411

contains G94A mutation in pSOD1

Elizabeth Fisher

Stevens et al PLoS One. 2010 . 5(3):e9541.

Nov. 8, 2010

Academic Institutions and Nonprofits only

#26403

Elizabeth Fisher

Stevens et al PLoS One. 2010 . 5(3):e9541.

Nov. 8, 2010

Academic Institutions and Nonprofits only

#101720

humanized, Neuron-specific promoter driven expression of the rhodopsin guanylyl cyclase from Catenaria anguillulae with a neuron-specific promoter. Useful for raising intracellular cAMP close to the m

Thomas Oertner

Scheib et al Nat Commun. 2018 May 24;9(1):2046. doi:

Jan. 2, 2018

Academic Institutions and Nonprofits only

#110693

Expresses a truncated form of CPSF6 (CPSF6-358 originally described in Lee et al. Cell Host Microbe 2010) fused with eGFP

Zandrea Ambrose

Ning et al J Virol. 2018 Apr 11. pii: JVI.00368-18.

July 25, 2018

Academic Institutions and Nonprofits only

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#209131

Enzymatic biotinylation of proteins at a specific lysine residue in a recognition sequence. This has multiple applications, especially in the study of protein-protein interactions.

Christopher A. O'Callaghan

O'callaghan et al Anal Biochem. 1999 Jan 1;266(1):9-15. do

March 6, 2024

Academic Institutions and Nonprofits only

#174667

Expresses GFP-endoNA2 fusion protein for detection of polysialic acid. The endoNA2 is a catalytically inactive form of endosialidase from bacteriophage PK1A2.

Jukka Finne

Jokilammi et al J Immunol Methods. 2004 Dec;295(1-2):149

Sept. 23, 2021

Academic Institutions and Nonprofits only

#185629

Modified tobacco rattle virus RNA2 vector expressing an sgRNA fused to trucated flowering locus T (BsaI-domesticated) which targets phytoene desaturase (PDS) of Nicotiana benthamiana

Nicola Patron

Dudley et al Commun Biol. 2022 Sep 10;5(1):949. doi:

Aug. 4, 2022

Academic Institutions and Nonprofits only