We narrowed to 11,462 results for: cat.1

#101720

humanized, Neuron-specific promoter driven expression of the rhodopsin guanylyl cyclase from Catenaria anguillulae with a neuron-specific promoter. Useful for raising intracellular cAMP close to the m

Thomas Oertner

Scheib et al Nat Commun. 2018 May 24;9(1):2046. doi:

Jan. 2, 2018

Academic Institutions and Nonprofits only

#110693

Expresses a truncated form of CPSF6 (CPSF6-358 originally described in Lee et al. Cell Host Microbe 2010) fused with eGFP

Zandrea Ambrose

Ning et al J Virol. 2018 Apr 11. pii: JVI.00368-18.

July 25, 2018

Academic Institutions and Nonprofits only

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#12145

Domenico Accili

Nakae et al EMBO J. 2000 Mar 1. 19(5):989-96.

Aug. 2, 2007

Academic Institutions and Nonprofits only

#241303

Mammalian expression of truncated form of synaptojanin-1 with CAAX motif fused to mVenus

Justin Taraska

Obashi et al Structure. Volume 34, Issue 1, 8 January

Dec. 11, 2025

Academic Institutions and Nonprofits only

#173213

Control vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +1 ATG insertion pegRNAs from two independent U6 promoters.

Yannick Doyon

Levesque et al Nat Commun. 2022 Oct 7;13(1):5909. doi:

Nov. 3, 2021

Academic Institutions and Nonprofits only

#209131

Enzymatic biotinylation of proteins at a specific lysine residue in a recognition sequence. This has multiple applications, especially in the study of protein-protein interactions.

Christopher A. O'Callaghan

O'callaghan et al Anal Biochem. 1999 Jan 1;266(1):9-15. do

March 6, 2024

Academic Institutions and Nonprofits only

#118210

Expresses FLAG-OTUB1 C91S catalytic inactive mutant in mammalian cells

Cynthia Wolberger

Pasupala et al J Biol Chem. 2018 Nov 23;293(47):18285-1

Oct. 31, 2018

Academic Institutions and Nonprofits only

#174667

Expresses GFP-endoNA2 fusion protein for detection of polysialic acid. The endoNA2 is a catalytically inactive form of endosialidase from bacteriophage PK1A2.

Jukka Finne

Jokilammi et al J Immunol Methods. 2004 Dec;295(1-2):149

Sept. 23, 2021

Academic Institutions and Nonprofits only

#185629

Modified tobacco rattle virus RNA2 vector expressing an sgRNA fused to trucated flowering locus T (BsaI-domesticated) which targets phytoene desaturase (PDS) of Nicotiana benthamiana

Nicola Patron

Dudley et al Commun Biol. 2022 Sep 10;5(1):949. doi:

Aug. 4, 2022

Academic Institutions and Nonprofits only

#202611

Double floxed genetically encoded voltage indicator (GEVI) JEDI-1P in AAV production vector expressed under the mammalian promoter (EF1a)

Francois St-Pierre

Lu et al Nat Commun. 2023 Oct 12;14(1):6423. doi:

June 21, 2023

Academic Institutions and Nonprofits only

#240582

Overexpress truncated alpha-Synuclein protein

Jennifer Lee

McGlinchey et al Nat Commun. 2025 Apr 23;16(1):3825. doi:

Aug. 1, 2025

Academic Institutions and Nonprofits only

#112799

Expression of OCTN2

Katarzyna Nalęcz

Czeredys et al PLoS One. 2013 Dec 13;8(12):e82105. doi:

Aug. 23, 2018

Academic Institutions and Nonprofits only

#133077

X. laevis expression vector. It will generate the human TRAAK channel

Dan Minor

Lolicato et al Neuron. 2014 Dec 17;84(6):1198-212. doi:

Oct. 30, 2021

Academic Institutions and Nonprofits only