We narrowed to 166,003 results for: addgene
-
Plasmid#236711Purpose3' AAVLINK plasmid for KDM5A expressionDepositorAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only
-
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
TagsNoneExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 E3GFP
Plasmid#233008PurposeGalactose iduced expression of Gcn4 E+GFP in yeastDepositorInsertGcn4 E+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationD105E, D118E, D139EPromoterGal1Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 F124IHA
Plasmid#232993PurposeGalactose iduced expression of Gcn4 F124IHA in yeastDepositorInsertGcn4 F124I
Tags3xHA and TEV cleavage siteExpressionYeastMutationF124IPromoterGal1Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
NarP-GFP
Plasmid#220161PurposeTo track the natural NarP promoter's transcriptional dynamicsDepositorInsertNarP promoter only
ExpressionBacterialAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WTSLFD
Plasmid#232980PurposeGalactose iduced expression of Gcn4 WTSLFD+ in yeastDepositorInsertGcn4 WTSLFD+
Tags3xHA and TEV cleavage siteExpressionYeastMutationF108W, E109T, Y110S, E111L, N112F, L113DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Aro2+
Plasmid#232982PurposeGalactose iduced expression of Gcn4 Aro2+ in yeastDepositorInsertGcn4 Aro2+
TagsTEV cleavage siteExpressionYeastMutationN116F, S117E, E119N, P129Q, T132YPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Aro3+
Plasmid#232983PurposeGalactose iduced expression of Gcn4 Aro3+ in yeastDepositorInsertGcn4 Aro3+
TagsTEV cleavage siteExpressionYeastMutationD103Y, N112T, L113Y, S117F, K140RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 W120AHA
Plasmid#232992PurposeGalactose iduced expression of Gcn4 W120AHA in yeastDepositorInsertGcn4 W120A
Tags3xHA and TEV cleavage siteExpressionYeastMutationW120APromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Aro3+HA
Plasmid#232990PurposeGalactose iduced expression of Gcn4 Aro3+HA in yeastDepositorInsertGcn4 Aro3+
Tags3xHA and TEV cleavage siteExpressionYeastMutationD103Y, N112T, L113Y, S117F, K140RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 44merHA
Plasmid#232988PurposeGalactose iduced expression of Gcn4 WT 44merHA in yeastDepositorInsertGcn4 WT 44mer
Tags3xHA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Aro2+HA
Plasmid#232989PurposeGalactose iduced expression of Gcn4 Aro2+HA in yeastDepositorInsertGcn4 Aro2+
Tags3xHA and TEV cleavage siteExpressionYeastMutationN116F, S117E, E119N, P129Q, T132YPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 F124IGFP
Plasmid#233005PurposeGalactose iduced expression of Gcn4 F124IGFP in yeastDepositorInsertGcn4 F124I
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationF124IPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WW+HA
Plasmid#232991PurposeGalactose iduced expression of Gcn4 WW+HA in yeastDepositorInsertGcn4 WW+
Tags3xHA and TEV cleavage siteExpressionYeastMutationE109N, S117D, T121W, N126W, T132WPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 W120AGFP
Plasmid#233004PurposeGalactose iduced expression of Gcn4 120AGFP in yeastDepositorInsertGcn4 W120A
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationW120APromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 K5
Plasmid#232966PurposeGalactose iduced expression of Gcn4 K+ in yeastDepositorInsertGcn4 K+
TagsTEV cleavage siteExpressionYeastMutationD103K, D115K, D127K, D133K, E143KPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only