We narrowed to 8,350 results for: 11
-
Plasmid#53566PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertChicken ArcLight-Q175
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable sinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAG25-L-IFP-F[1] (clon 3)
Plasmid#52899PurposePlasmid template for PCR of cassettes for HR, used to introduce IFP F[1] fragments 3’ to the ORF of the genes to study. Plasmid confers ampicillin resistance to DH5α.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertL-IFP-F[1]
UseVector for homologous recombinationPromoterTEF promoterAvailable sinceJune 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAG32-L-IFP-F[2] (clon 3)
Plasmid#52900PurposePlasmid template for PCR of cassettes for HR, used to introduce IFP F[2] fragments 3’ to the ORF of the genes to study. Plasmid confers ampicillin resistance to DH5α.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertL-IFP-F[2]
UseVector for homologous recombinationPromoterTEF promoterAvailable sinceJune 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
NELFE-mOrange pHis-//
Plasmid#53303PurposeExpresses His-tagged NELF-E-mOrange fusion protein.DepositorAvailable sinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
p029 End-1::EnR
Plasmid#11029DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAUseXenopus, mammalian, avian, and zebrafishMutationDominant inhibitory GATA-binding protein End1::En…Available sinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pSEVA621-AzFRS
Plasmid#242002PurposeExpressed AzF tRNA synthetase for incorporation of p-azido-L-phenylalanine (pAzF)DepositorInsertAzFRS
ExpressionBacterialAvailable sinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiRNACRISPR_011-TetO-NLS-inactive-RfxCas13d-NLS-WPRE-EFS-rtTA3-2A-Blast
Plasmid#228557PurposeExpresses inactive RfxCas13d in mammalian cells for binding of target RNAs in combination with compatible crRNAs. Localized to the nucleusDepositorInsertdRfxCas13d
UseLentiviralTagsNLS-HAMutationR239A/H244A/R858A/H863AAvailable sinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
Venus-rab7a
Plasmid#234743PurposeMammalian expression of late endosome marker Venus-rab7aDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertVenus-rab7a (Rab7 Mouse)
ExpressionMammalianPromoterCMVAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNeonGreen-C1-Nir2-LNS2
Plasmid#220086PurposeC-terminal PA binding domain of Nir2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPITPNM1 (PITPNM1 Human)
TagsNeonGreen-GGSGGMExpressionMammalianMutationamino acids 896-1216PromoterCMVAvailable sinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFN18A-HaloTag-SpyCatcher
Plasmid#206041PurposeHaloTag-Spy0128-(Protein of Interest)-Spy0128-SpyCatcher-8xHisTagDepositorTypeEmpty backboneTagsHaloTag and SpyCatcher-8HisExpressionBacterialPromoterT7Available sinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-mCherry-C
Plasmid#203326PurposeExpress N-terminal mCherry-fused protein in mammalian cellDepositorTypeEmpty backboneTagsmCherryExpressionMammalianPromoterCAGAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDH-EMTB-TurboID-V5-puro
Plasmid#190741PurposeA lentiviral plasmid encoding EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertEMTB-TurboID-V5 (RPS14 Human, EMTB is human ensconsin; TurboID is engineered BirA from E.coli)
UseLentiviralTagsMycExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable sinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Kif5a-Myc
Plasmid#186613PurposeThird generation lentiviral vector expressing Kinesin Heavy Chain 5 isoform A fused to Myc tagDepositorInsertKinesin Heavy Chain isoform 5A (KIF5A Human)
UseLentiviralTagsMyc tagExpressionMammalianPromoterCMVAvailable sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-DCX-TurboID-V5-puro
Plasmid#190742PurposeA lentiviral plasmid encoding DCX fusion to V5-tagged TurboID on microtubules (DCX as the microtubule-targeting tag)DepositorInsertDCX-TurboID-V5 (DCX Human, DCX is human doublecortin; TurboID is engineered BirA from E.coli)
UseLentiviralExpressionMammalianPromoterCMVAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT003
Plasmid#182713PurposeaTc inducible dCasRx-IF3DepositorInsertdCasRx
UseCRISPRTags3x(GGGS)-Escherichia Coli Initiation Factor 3ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpTetAvailable sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCJH002_10xHis-MBP-TEVcs-Cas12c(4)_Amp
Plasmid#183069PurposeBacterial protein expression plasmid of wild-type Cas12c_4. This is a R965H version of the Cas12c in Harrington et al., 2020.DepositorInsertCas12c_4
UseCRISPRTagsHis10 and MBPExpressionBacterialMutationWild-typeAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-gRNA_BbsI_CAM
Plasmid#183222PurposeLbCas12a gRNA containing BbsI restriction recognition sites in spacer sequence for Golden Gate AssemblyDepositorInsertLbCas12a guide RNA containing BbsI sites in spacer sequence
UseCRISPRExpressionBacterialAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GABRA1(A322D)-IRES2-EGFP
Plasmid#170821Purposehuman GABAA receptors alpha1 subunit carrying A322D mutation and IRES2-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHuman GABAA receptor alpha1 subunit carrying A322D mutation (GABRA1 Human)
TagsIRES2-EGFPExpressionMammalianMutationchange Alanine 322 to AspartateAvailable sinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTYF-PRSx8-AstR-p2A-GFP
Plasmid#159632PurposeLentiviral expression of the Allatostatin receptor, P2A GFP under the PRSx8 promoterDepositorAvailable sinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only