We narrowed to 9,410 results for: GCA
-
Plasmid#62262Purposeexpression of A4T sgRNA from the arabinose-inducible promoterDepositorInsertA4T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4T
Plasmid#62262Purposeexpression of A4T sgRNA from the arabinose-inducible promoterDepositorInsertA4T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1NT
Plasmid#62255Purposeexpression of A1NT sgRNA from the arabinose-inducible promoterDepositorInsertA1NT
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1NT
Plasmid#62255Purposeexpression of A1NT sgRNA from the arabinose-inducible promoterDepositorInsertA1NT
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJYS3_ΔcrtYf
Plasmid#85542PurposeConstitutive transcription of FnCpf1 and crRNA of crtYfDepositorInsertsCpf1
crRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJYS3_ΔcrtYf
Plasmid#85542PurposeConstitutive transcription of FnCpf1 and crRNA of crtYfDepositorInsertsCpf1
crRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
L1_lacZgRNA-Ck3
Plasmid#136136PurposeL1 in position 3, to clone gRNA target using BbsI, lacZ blue-white screeningDepositorInsertp5-MpU6:lacZgRNA
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
L1_lacZgRNA-Ck3
Plasmid#136136PurposeL1 in position 3, to clone gRNA target using BbsI, lacZ blue-white screeningDepositorInsertp5-MpU6:lacZgRNA
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop A
Plasmid#171779PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-DogTag Loop A
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Val2…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop A
Plasmid#171779PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-DogTag Loop A
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Val2…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
L1_lacZgRNA-Ck2
Plasmid#136137PurposeL1 in position 2, to clone gRNA target using BbsI, lacZ blue-white screeningDepositorInsertp5-MpU6:lacZgRNA
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
L1_lacZgRNA-Ck2
Plasmid#136137PurposeL1 in position 2, to clone gRNA target using BbsI, lacZ blue-white screeningDepositorInsertp5-MpU6:lacZgRNA
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mU6-GFPGO2-IRES-mScarletI
Plasmid#136896PurposeLentivirus for base editing activatable GFP expression in mammalian cells. All-in-one vector with sgGO.DepositorInsertGFPGO2-IRES-mScarletI
UseLentiviralTags2xNLS on GFP, 3xNLS on mScarletMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mU6-GFPGO2-IRES-mScarletI
Plasmid#136896PurposeLentivirus for base editing activatable GFP expression in mammalian cells. All-in-one vector with sgGO.DepositorInsertGFPGO2-IRES-mScarletI
UseLentiviralTags2xNLS on GFP, 3xNLS on mScarletMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-PCNT
Plasmid#227284PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of PCNT for knock-in.DepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PCNT
Plasmid#227284PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of PCNT for knock-in.DepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
D. vulgaris sp2 CRISPR/pACYCDuet-1
Plasmid#81186PurposeExpresses CRISPR array containing 3 copies of Desulfovibrio vulgaris spacer 2 and flanking repeats in E. coliDepositorInsertSynthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
UseCRISPRTagsNoneExpressionBacterialPromoterT7Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
D. vulgaris sp2 CRISPR/pACYCDuet-1
Plasmid#81186PurposeExpresses CRISPR array containing 3 copies of Desulfovibrio vulgaris spacer 2 and flanking repeats in E. coliDepositorInsertSynthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
UseCRISPRTagsNoneExpressionBacterialPromoterT7Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only