We narrowed to 4,082 results for: Gaa
-
Plasmid#185055PurposeDeletion of BHLH domain of mouse TFAP4 in combination with TFAP4_BHLH_5-1 or TFAP4_BHLH_5-2DepositorInsertTFAP4_3_2_gRNA (Tcfap4 Mouse)
UseLentiviralAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056J
Plasmid#183136PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-mAK1-shRNA-1
Plasmid#185364PurposeFor mammalian expression of shRNA: ATCTTGACTCCCTGAAGTAAC that targets mouse AK1 (adenylate kinase)DepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_sgRNA_Ago1_6
Plasmid#172471PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1.DepositorInsertsgAgo1
UseCRISPRExpressionMammalianPromoterhU6Available SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP938-pX330-Slc17a7
Plasmid#181775PurposeCRISPR/Cas9 guide vectorDepositorInsertSlc17a7 guide
UseCRISPRExpressionMammalianAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP939-pX330-Ctxn3
Plasmid#181769PurposeCRISPR/Cas9 guide vectorDepositorInsertCtxn3 guide
UseCRISPRExpressionMammalianAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEh_gRNA1
Plasmid#178758PurposeExpression of a gRNA that targets next to PAM library, used for E. haloalkaliphila type I-E systemDepositorInsertgRNA that targets next to PAM library, used for E. haloalkaliphila type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMs_gRNA1
Plasmid#178764PurposeExpression of a gRNA that targets next to PAM library, used for Marinomonas sp. type I-E systemDepositorInsertgRNA that targets next to PAM library, used for Marinomonas sp. type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLm_gRNA1
Plasmid#178752PurposeExpression of a gRNA that targets next to PAM library, used for L. mobilis type I-E systemDepositorInserta gRNA that targets next to PAM library, used for L. mobilis type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc2_gRNA1
Plasmid#178740PurposeExpression of a gRNA that targets next to PAM library, used for A. chroococcum type I-E #2 systemDepositorInsertgRNA that targets next to PAM library, used for A. chroococcum type I-E #2 system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL22A
Plasmid#166079PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL22A for double stranded break formation in yeast.DepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-2
Plasmid#164859PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-2
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-3
Plasmid#164860PurposeConstitutive expression of single-spacer CRISPR array with spacer #3 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-3
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS424-ysg(NT)
Plasmid#138258PurposeExpression of a non-targeting sgRNA to be used as a control in a yeast dual reporter systemDepositorInsertNontargeting sgRNA
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSM002
Plasmid#122936PurposeExpression of the marked mRNA under the control of substitutional promoters.DepositorInsertYML043C (Marked)
ExpressionYeastMutationYML043C: bp 52-63 AAGTTAAAGTAT to AAATTGAAATACPromoter[tetO2]4inPgal1Available SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSM001
Plasmid#122935PurposeExpression of the marked mRNA under the control of substitutional promoters.DepositorInsertYML029W (Marked)
ExpressionYeastMutationYML029W: bp 52-63 GAGATTGATCTT to GAAATAGACCTAPromoter[tetO2]4inPgal1Available SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSV_243
Plasmid#122940PurposeExpression of the marked mRNA under the control of insertional promoters.DepositorInsertYML029W (Marked)
ExpressionYeastMutationYML029W: bp 52-63 GAGATTGATCTT to GAAATAGACCTAPromoterPyml029w-tetO(2)Available SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSV_228
Plasmid#122933PurposeExpression of the marked mRNA under the control of substitutional promoters.DepositorInsertYBR025C (Marked)
ExpressionYeastMutationYBR025C: bp 52-63 GGTAATAACTTG to GGAAACAATTTAPromoter[tetO2]4inPgal1Available SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only