We narrowed to 18,781 results for: multi
-
Plasmid#62096PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a SV40 promoter and multiple cloning site module. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseMule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pMuLE ENTR CMV R4-R3
Plasmid#62093PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and multiple cloning site module. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseMule gateway entry vectorExpressionMammalianAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pONL-N1_3xNLS
Plasmid#65674PurposeExpresses NLS-ONL in mammalian cellsDepositorInsertthree copies of SV40 nuclear localization signal
UseLuciferaseTagsONLExpressionMammalianPromoterCMVAvailable SinceJune 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pONL-N1_TUBB5
Plasmid#65680PurposeExpresses beta-tubulin-ONL in mammalian cellsDepositorInsertbeta-tubulin class V
UseLuciferaseTagsONLExpressionMammalianPromoterCMVAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pM2_PLLaco1R1CI*_PLTetO1R1CI*
Plasmid#250895PurposeCassette 1: Mutated cI protein expressed under PL TetO1 promoter; Cassette 2: Mutated cI protein expressed under PL LacO1 promoter; part of BNeu AS10; colE1 origin of replicationDepositorInsertsMutated cI
Mutated cI
UseSynthetic BiologyMutationcI* = Frame shifted cI proteinPromoterPL LacO1 and PL TetO1Available SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pK1_PLLacO1R3CIw_PLTetO1R2CIw
Plasmid#250893PurposeCassette 1: Wild type cI protein expressed under PL TetO1, regulated by RBS 'R2'; Cassette 2: Wild type cI protein expressed under PL LacO1 and regulated b RBS 'R3'; part of Bneu AS7; p15A originDepositorInsertsWild type cI
Wild type cI
UseSynthetic BiologyPromoterPL LacO1 and PL TetO1Available SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBK-EcTyrRS-VSMA
Plasmid#247683PurposeExpressed E. coli tyrosyl synthetase for multiplexed BONCAT bacteriaDepositorInsertE. coli tyrosyl tRNA synthetase VSMA mutant
ExpressionBacterialPromoterglnSAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag43-iCAM-tether
Plasmid#205211PurposeThis vector encodes of the synCAM tether (iCAM1) and GFP nanobody LAG43DepositorInsertsynCAM iCAM1 tether and Lag43 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag29-iCAM-1
Plasmid#205208PurposeThis vector encodes of the synCAM (iCAM1) and GFP nanobody LAG29DepositorInsertsynCAM iCAM1 and Lag29 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag43-iCAM-1
Plasmid#205206PurposeThis vector encodes of the synCAM (iCAM1) and GFP nanobody LAG43DepositorInsertsynCAM iCAM1 and Lag43 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::HA-RfA
Plasmid#186411PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion N-ter HA tag-gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::venus-RfA
Plasmid#186408PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter Venus under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-CFP
Plasmid#186412PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter CFP under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-venus
Plasmid#186409PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion N-ter Venus-gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-HA
Plasmid#186410PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter HA tag under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_ReBphP-PCM_IRES_sfGFP
Plasmid#166917PurposeExpress ReBphP-PCM and sfGFPDepositorInsertsReBphP-PCM
sfGFP
ExpressionMammalianPromoterCMVAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only