We narrowed to 8,876 results for: sgrna
-
Plasmid#189925PurposeAAV genome encoding SauriABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSauriABE8e
UseAAVMutationSauriCas9 D15APromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP
Plasmid#60955PurposeParental vector for the CRISPRi/a libraries. Expresses an sgRNA from the U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_puro optimized backbone
Plasmid#73797Purposeoptimized lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#159281PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)DepositorInsertAsCpf1-HA-2A-GFP
UseMulticistronic vector with both caggs promoter-dr…Tags3X HAExpressionMammalianPromoterU6Available SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTol2-hsp70l:Cas9-t2A-GFP, 5xU6:sgRNA
Plasmid#108871PurposeExpression of heat shock inducible Cas9-GFP and U6-driven 5 individual gRNAs for scGESTALT in zebrafishDepositorInserts5xU6:sgRNA
Cas9-t2A-GFP
UseCRISPRPromoterU6 and hsp70Available SinceApril 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA Ef1alpha Puro-T2A-GFP
Plasmid#111596PurposesgRNA Ef1alpha Puro-T2A-GFPDepositorInsertmU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingExpressionMammalianPromoterU1a and U6Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only