We narrowed to 14,709 results for: ung
-
Plasmid#212136PurposeCargo plasmid for integrating PT7 expression cassette of green fluorescent protein in genome.Plasmid can be removed by incubating cells at 37 C.DepositorInsertgreen fluorescent protein
ExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUiLMO2W
Plasmid#129480Purpose3rd-generation lentiviral vector for iLMO2, an opto-chemogenetic probe for neuronal inhibition by light or chemicalDepositorInsertiLMO2
UseLentiviralExpressionMammalianPromoterhuman ubiquitin CAvailable SinceFeb. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-iLMO2
Plasmid#129474PurposeMammalian expression vector for iLMO2, an opto-chemogenetic probe for neuronal inhibition by light or chemicalDepositorInsertiLMO2
ExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-mVenusC-14-HP1b Chromo
Plasmid#191398PurposeHP1b chromo domain fused to C-terminal part of split mVenusDepositorInsertFLAG-mVenusC-14-HP1b Chromo
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS41K-mScarlet-I-mNeonGreen-ADH1term-TEFpr-hphΔC (pKBJ011)
Plasmid#173462PurposeC-SWAT donor for Selection Reconstitution tagging, contains mScarletI-mNeonGreen tandem fluorescent protein timerDepositorInsertmScarlet-I-mNeonGreen
ExpressionYeastPromoterno promoterAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS41K-mCherry-mNeonGreen-ADH1term-TEFpr-hphΔC (pJJF004)
Plasmid#173460PurposeC-SWAT donor for Selection Reconstitution tagging, contains mCherry-mNeonGreen tandem fluorescent protein timerDepositorInsertmCherry-mNeonGreen
ExpressionYeastPromoterno promoterAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS41K-mCherry-sfGFP-ADH1term-TEFpr-hphΔC (pJJF002)
Plasmid#173458PurposeC-SWAT donor for Selection Reconstitution tagging, contains mCherry-sfGFP tandem fluorescent protein timerDepositorInsertmCherry-sfGFP
ExpressionYeastPromoterno promoterAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJBL710
Plasmid#140380PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 14BP dowsntream from the promoterDepositorInsertT7-14BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL702
Plasmid#140372PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 0BP dowsntream from the promoterDepositorInsertT7-0BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL706
Plasmid#140376PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 6BP dowsntream from the promoterDepositorInsertT7-6BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL707
Plasmid#140377PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 8BP dowsntream from the promoterDepositorInsertT7-8BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL708
Plasmid#140378PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 10BP dowsntream from the promoterDepositorInsertT7-10BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL709
Plasmid#140379PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 12BP dowsntream from the promoterDepositorInsertT7-12BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-REG1-3'UTR
Plasmid#136052PurposeREG1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (ATTGTATCTCTGTAGTTTAAG)DepositorAvailable SinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNIC28-BSA4-S15
Plasmid#127821PurposeProduction of recombinant human ribosomal protein S15DepositorAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNH-TrxT-G-T136D-S15
Plasmid#127824PurposeProduction of recombinant human ribosomal protein S15DepositorInsertRPS15 (RPS15 Human)
TagsHis6 - Thioredoxin - TEVExpressionBacterialMutationT136DPromoterT7Available SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSKB3-SaGGR-F219L (JBEI-7186)
Plasmid#110151PurposepSKB3 with TEV-cleavable, N-terminal His-tagged SaGGR-F219L mutant geneDepositorInsertGGR
TagsTEV-cleavable His-tagExpressionBacterialMutationSaGGR-F219L mutant genePromoterT7Available SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-SERTN177E-myc
Plasmid#107474PurposeMammalian expression plasmid for codon optimized mutant hSERT with internal MYC tag inserted in ECL2, mutation N177E with approximately wildtype activityDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-SERTY289I-myc
Plasmid#107480PurposeMammalian expression plasmid for codon optimized mutant hSERT with internal MYC tag inserted in ECL2, mutation Y289I with approximately wildtype activityDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-SERTR596Q-myc
Plasmid#107483PurposeMammalian expression plasmid for codon optimized mutant hSERT with internal MYC tag inserted in ECL2, mutation R596Q conferring gain of function phenotypeDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only