We narrowed to 7,952 results for: 11
-
Plasmid#204519PurposeBacterial expression of CEC-8 N-terminal fragment with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertN-terminal fragment of cec-8 (C. elegans) (Y55B1BR.3 Nematode)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT342
Plasmid#204514PurposeBacterial expression of SYP-1 N-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertN-terminal fragment of syp-1 (C. elegans)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT320
Plasmid#204517PurposeBacterial expression of HIM-1 internal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertInternal fragment of him-1 (C. elegans) (him-1 Nematode)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
NeuA.pJL1
Plasmid#199115PurposeIn vitro expression of N-acylneuraminate cytodiylyltransfease (NeuA), which conjugates sialic acid and CTP to make activated sugar donor, CMP-sialic acid (see CSTI.PJL1 and PdST6.PJL1)DepositorInsertN-acylneuraminate cytodiylyltransfease (NeuA)
TagsStrep-tagExpressionBacterialPromoterT7Available SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Derp2.pJL1
Plasmid#199116PurposeIn vitro expression of Der p 2, a major common allergen from Dermatophagoides pteronyssinus (dust mite), with synthetic site for glycosylation encoded (GGNWTT)DepositorInsertDer p 2 dust mite allergen
TagsGlyctag, His-tagExpressionBacterialPromoterT7Available SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM-60-NusA-DmEDC3_1-101_D
Plasmid#146126PurposeBacterial Expression of DmEDC3_1-101DepositorInsertDmEDC3_1-101 (Edc3 Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmNot1_1963-2505-dsRNAres_AC
Plasmid#148403PurposeInsect Expression of Dmot1_1963-2502-dsRNAresDepositorInsertDmot1_1963-2502-dsRNAres
ExpressionInsectMutation2 silent mutations compared to the sequence given…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-HsNot7-D40AE42A_AF
Plasmid#148675PurposeBacterial Expression of HsNot7-D40AE42ADepositorInsertHsNot7-D40AE42A (CNOT7 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-HsNot7-NpM-HsNot6_AF
Plasmid#148645PurposeBacterial Expression of HsNot7-HsNot6DepositorInsertHsNot7-HsNot6 (CNOT7 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Rtn2b-R60f-mCherry
Plasmid#186607PurposeThird generation lentiviral vector expressing Reticulon 2 disease mutant R60f fused to mCherryDepositorInsertHuman Reticulon 2 mutant R60f (RTN2 Human)
UseLentiviralTagsmCherryExpressionMammalianMutationc.178insC (R60f)PromoterCMVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Rtn2b-mNeon-TurboID
Plasmid#186612PurposeThird generation lentiviral vector expressing full-length Reticulon 2 fused to mNeonGreen and V5-TurboIDDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Rtn2b-NTD1-271-mNeon
Plasmid#186601PurposeEncodes human Reticulon 2 isoform B N-terminal domain aa 1 to 271 fused to mNeonGreenDepositorInsertHuman Reticulon 2 isoform B amino acids 1 to 271 (RTN2 Human)
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Rtn2b-NTD1-135-mNeon
Plasmid#186602PurposeEncodes human Reticulon 2 isoform B N-terminal domain aa 1 to 135 fused to mNeonGreenDepositorInsertHuman Reticulon 2 isoform B amino acids 1 to 135 (RTN2 Human)
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Rtn2b-NTD1-60-mNeon
Plasmid#186603PurposeEncodes human Reticulon 2 isoform B N-terminal domain aa 1 to 60 fused to mNeonGreenDepositorInsertHuman Reticulon 2 isoform B amino acids 1 to 60 (RTN2 Human)
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Rtn2b-NTD136-271-mNeon
Plasmid#186604PurposeEncodes human Reticulon 2 isoform B N-terminal domain aa 136 to 271 fused to mNeonGreenDepositorInsertHuman Reticulon 2 isoform B amino acids 136 to 271 (RTN2 Human)
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-VC155
Plasmid#194051PurposeTransient expression of VN155 (mVenus β-strands 8 to 11, amino acids 155−239) in plant cell (Cytosol)DepositorInsertVC155 (mVenus β-strands 8 to 11, amino acids 155−239)
ExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_ST-sgRNA
Plasmid#188705PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and 4 sgRNAs targeting human safe targeting lociDepositorInsertST sgRNAs
UseLentiviralExpressionMammalianPromoterhUbCAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-mCCK2R-stop
Plasmid#179321PurposeExpress mouse cholecystokinin 2 receptor (untagged) in mammalian cellsDepositorInsertmouse cholecystokinin2 receptor
ExpressionMammalianMutationstop codon after ORFPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only