We narrowed to 15,154 results for: GRN

#89955

Contains arabinose-induced lambda Red and a tet-inducible gRNA targeting trmI.

Michael Lynch

Moreb et al ACS Synth Biol. 2017 Oct 2. doi: 10.1021

June 19, 2017

Academic Institutions and Nonprofits only

#87409

p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87391

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87392

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87395

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87397

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#81210

for targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 3' of gix site)

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#81216

pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch12 reporter

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#81207

for targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 5' of gix site)

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#81208

for targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 5' of gix site)

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#72890

plasmid to generate guideRNA against mmp21 gene in zebrafish

Nicholas Katsanis

Perles et al J Med Genet. 2015 Dec;52(12):840-7. doi:

Feb. 16, 2016

Academic Institutions and Nonprofits only

#139086

Expresses human codon-optimized SpCas9 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.

Neville Sanjana

Legut et al Cell Rep. 2020 Mar 3;30(9):2859-2868.e5.

March 6, 2020

Academic Institutions and Nonprofits only

#243748

PVC cargo/regulatory region - deleted toxin cargos (Pdp1/Pnf) - vegfa sgRNA - Cre loaded into the PVC tube via Pdp1 (NTD)

Feng Zhang

Kreitz et al Nat Biotechnol. 2025 Aug 12. doi: 10.103

Sept. 24, 2025

Academic Institutions and Nonprofits only