We narrowed to 11,399 results for: nar;
-
Plasmid#160992PurposeExpress fulllength of mouse p150 proteinDepositorAvailable SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only
-
LLP790_αGCN4-EZH2-FL-CO
Plasmid#211784PurposeSunTag counterpart binding domain, aGCN4, fused to polycomb repressive complex subunit EZH2, with GFP selectionDepositorInsertSnoopCatcher-KRAB
Tags2xOLLASExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
ScFv-2ERT2-V
Plasmid#120553Purpose3rd gen transfer vector. Encode an antibody that binds to the GCN4 peptide from the SunTag system, and is fused to sfGFP, 2 tandem ERT2 and VP64.DepositorInsertscFvGCN4, sfGFP, GB1, ERT2, VP64
UseLentiviralExpressionMammalianPromoterhPGKAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
KJ901: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS
Plasmid#121835PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-Drosha1-390
Plasmid#62521PurposeC-terminal aa391-1374 of Drosha is deletedDepositorInserthuman Drosha with aa 391-1374 deleted (DROSHA Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 391-1374Available SinceMarch 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
IF311: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-LSD1
Plasmid#121824PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCML 961
Plasmid#98848PurposepTriFC_aidB. Expresses protein-NYFP and 2MS2BD-5' UTR mStrawberry fusions in E. coli for Dual-fluorescence TriFC assay (ampR).DepositorInserts5' UTR + first 100 nucleotides of coding sequence of the aidB gene
csrA
ExpressionBacterialPromoterpLacOAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_Omega2_Pnos:GR:LacIBD:Gal4AD:Tnos-OplacI:mini35S:RDF:Tnos (GB1678)
Plasmid#160642PurposeModule for the dexamethasone -inducible expression of PhiC31 phage recombination directionality factor (RDF) gene.DepositorInsertGRLacIBDGal4AD / RDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Drosha1-850
Plasmid#62522PurposeC-terminal aa851-1374 of Drosha is deletedDepositorInserthuman Drosha with aa 851-1374 deleted (DROSHA Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 851-1374Available SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
IX301: pMVP (L3-L2) myc epitope tag + polyA
Plasmid#121753PurposepMVP L3-L2 entry plasmid, contains myc epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertmyc epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-21a_2xNLS_FnCpf1_MBP_protein_expression
Plasmid#120801PurposeProtein expression plasmid for 2xNLS FnCpf1 in pET-21a backboneDepositorInsert2xNLS_FnCpf1
UseCRISPRTagsMBP and NLSExpressionBacterialPromoterT7Available SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
IX601: pMVP (L3-L2) FLAG epitope tag + polyA
Plasmid#121751PurposepMVP L3-L2 entry plasmid, contains FLAG epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertFLAG epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AtTAS1c-D2-B/c
Plasmid#137883PurposeGateway-compatible entry vector for direct cloning of synthetic trans-acting siRNAs into Arabidopsis thaliana TAS1c precursor at position downstream 3'D1[+]DepositorInsertAtTAS1c-D2-B/c
UseGateway-compatible entry cloneMutationA. thaliana TAS1c precursor sequence including a …Available SinceMay 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
KZ401: pMVP (L3-L2) P2A-Neo + polyA
Plasmid#121781PurposepMVP L3-L2 entry plasmid, contains Neo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Neo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Neo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ601: pMVP (L3-L2) P2A-Zeo + polyA
Plasmid#121783PurposepMVP L3-L2 entry plasmid, contains Zeo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Zeo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Zeo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF11-SFPQ(214-598)
Plasmid#135440PurposeExpresses SFPQ 214-598 with TEV-cleavable hexahistidine tagDepositorInsertsplicing factor proline and glutamine rich (SFPQ Human)
TagsHexahistidineExpressionBacterialPromoterT7Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTE3987
Plasmid#137716PurposeExpresses dLbCas12a-RVRR-BE in mammalian cells.DepositorInsertdLbCas12a-RVRR-BE
Tags6xHis, APOBEC-1, SV40 NLS, and UGIExpressionMammalianMutationG532A, K538V, Y542R, K595RPromoterCMVAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF11-SFPQ(276-535)
Plasmid#135436PurposeExpresses SFPQ 276-535 with TEV-cleavable hexahistidine tagDepositorInsertsplicing factor proline and glutamine rich (SFPQ Human)
TagsHexahistidineExpressionBacterialPromoterT7Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only