We narrowed to 5,950 results for: paav
-
Plasmid#217398PurposeExpresses the hM4D(Gi) inhibitory DREADD fused to mCherry, in a Cre-ON and FLP-OFF dependent manner, under the control of hSyn promoterDepositorInserthM4D(Gi)-mCherry
UseAAVTagsmCherryExpressionMammalianMutationPromoterhuman Synapsin 1Available SinceMay 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn1-DIO-Snca (human A53T)
Plasmid#214201PurposeFor Cre-dependent expression of alpha synuclein (human gene containing A53T mutation)DepositorInsertSnca (A53T) (SNCA Human)
UseAAV and Cre/LoxTagsExpressionMammalianMutationA53TPromoterAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1992 - pAAV EF1a CoV2 Orf3a-2xStrep
Plasmid#213542PurposeAAV viral vector packaging plasmid that expresses CoV2DepositorInsertCoV2 Orf3a-2xStrep (ORF3a Severe acute respiratory syndrome coronavirus 2, Human)
UseAAVTagsExpressionMutationPromoterEF1aAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1993 - pAAV EF1a CoV2 protE-2xStrep
Plasmid#213543PurposeAAV viral vector packaging plasmid that expresses CoV2DepositorInsertCoV2 protE-2xStrep (E Severe acute respiratory syndrome coronavirus 2, Human)
UseAAVTagsExpressionMutationPromoterEF1aAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-myr-rsEGFP2- LDLR
Plasmid#213399Purposedouble floxed, myristoylation site (myr) and LDLR, fused to reversibly switchable EGFP rsEGFP2DepositorInsertrsEGFP2
UseAAVTagsC-terminal (Ct) cytoplasmic domains of low densit…ExpressionMammalianMutationPromoterAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-Lmna sgRNA
Plasmid#206979PurposeExpresses SauriABE8e by EFS promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertLmna sgRNA
UseAAV; Adenine base editorTagsExpressionMutationPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cFOS-FRB-VP16-P2A-EGFP
Plasmid#210510Purposeexpresses cFOS-FRB-VP16 and EGFP component in rat hippocampal neuron cellsDepositorInsertFRB-VP16-P2A-EGFP
UseAAVTagsExpressionMammalianMutationPromotercFosAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgNtsr1(guide_2)
Plasmid#205417PurposeMutagenesis of Ntsr1, second guideDepositorAvailable SinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-9-SV40 polyA
Plasmid#190873PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode9
UseAAVTagsExpressionMutationWTPromoterAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorInsertGFP, sgHTT and sgCas9 (HTT Human)
UseAAV and CRISPRTagsExpressionMutationPromoterEFS and U6Available SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(103)-GFP
Plasmid#197890PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(553)-GFP
Plasmid#197888PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(285)-GFP
Plasmid#197889PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-P2A-puro
Plasmid#192131PurposeExpresses Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9
UseAAVTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-KY-P2A-puro
Plasmid#192133PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-KY
UseAAVTagsExpressionMammalianMutationHsp1-Hsp2Cas9 (K390A, Y446A)PromoterAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-Y-P2A-puro
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVTagsExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)PromoterAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CBA::EGFP-P2A-tC3-FLAG
Plasmid#129477PurposeAAV2 transfer plasmid for truncated C3 tagged with FLAG with EGFP under control of the CBA promoterDepositorInsertFLAG-tagged (C-terminus) truncated (AA173-201) exoenzyme C3 from C. botulinum, P2A, EGFP
UseAAVTagsExpressionMammalianMutationPromoterCBAAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVTagsExpressionMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOttc1473 - pAAV CaMKII KDELR2-Myc-DDK
Plasmid#192600PurposeAn AAV packaging vector that expresses KDELR2 under control of the CaMKII promoter.DepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only