We narrowed to 9,206 results for: sgRNA
-
Plasmid#212963PurposeLentiviral plasmid for the measurement of RfxCas13d (CasRx) nuclease activity. As a marker, the plasmid also encodes the tRFP657 fluorescence protein.DepositorInsertDR1_CasRx_GFP targeting spacer
UseCRISPR and LentiviralTagsTagRFP657ExpressionMammalianPromoterU6Available sinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Human Brunello kinome pooled library, guides 1-4 in lentiCRISPRv2 backbone
Pooled library#75314PurposeHuman sgRNA library in backbone lentiCRISPRv2 targeting 763 kinase genes and containing 3,052 unique sgRNAs along with 100 non-targeting controlsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-EZR
Plasmid#227293PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of EZR for knock-in.DepositorAvailable sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PEA1
Plasmid#176527PurposeDelivers all prime editing nickase components in a single plasmidDepositorInsertCbH-Cas9(H840A)-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRExpressionMammalianPromoterCbH for Cas9, hU6 for gRNAsAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-U6gRNA2-Filler
Plasmid#237401PurposeFor the sequential insertion of two guide RNAs into two U6gRNA cassettes.DepositorInsertsU6gRNA-1
U6gRNA-2
PGK-TagBFP
UseCRISPR and RetroviralExpressionMammalianPromoterPGK promoter, U6 promoter, and U6, PGKAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-Puro-BsmBI_entry (pRW1484)
Plasmid#225752PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with Puromycin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorPublicationTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgPal7 (p2Tol-U6-sgPal7-HygR)
Plasmid#71484PurposeExpresses palindromic sgRNA for use in self-cloning CRISPRDepositorInsertsgPal7
PromoterU6Available sinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFREE2-xCas9-sgRNA
Plasmid#179579PurposeExpresses xCas9 and gRNA that targets ColE1 plasmids for curing.DepositorInsertxCas9
ExpressionBacterialAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6 SgRNA GAPDH
Plasmid#162736PurposeMammalian expressionDepositorInsertSpacer sequence for GAPDH
UseCRISPRExpressionMammalianPromoterU6Available sinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato90/816
Plasmid#179918PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 90 and 816.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry empty
Plasmid#80975PurposeCas9, mCherry, and sgRNA expressionDepositorTypeEmpty backboneExpressionMammalianAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LentiCRISPR-B_sgRNA_EXOSC8 (pP18(T)_B1-AVA4071)
Plasmid#239306PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC8DepositorInsertU6-driven sgRNA targeting EXOSC8 (EXOSC8 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC9 (pP18(T)_A7-AVA4072)
Plasmid#239307PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC9DepositorInsertU6-driven sgRNA targeting EXOSC9 (EXOSC9 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC4 (pP18(T)_C11-AVA4065)
Plasmid#239302PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC4DepositorInsertU6-driven sgRNA targeting EXOSC4 (EXOSC4 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
lenti.Cas9.BFP.sgRNA.parental
Plasmid#196715PurposeSortable WT-SpCas9 expression and guide cassette (1-vector system).DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only