We narrowed to 17,478 results for: IGH@
-
Plasmid#195729PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#15 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F17
Plasmid#195731PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#17 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F19
Plasmid#195733PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#19 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F2
Plasmid#195716PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#2 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F11
Plasmid#195725PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#11 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F16
Plasmid#195730PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#16 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F18
Plasmid#195732PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#18 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F1
Plasmid#195715PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#1 of a 24 fragment split in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F9
Plasmid#195723PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#9 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F23
Plasmid#195737PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#23 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F21
Plasmid#195735PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#21 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
TTR C10S E63C
Plasmid#190009PurposeExpression of human TTR in E coliDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-MAVS-mTA2
Plasmid#171000PurposeHiLITR protease with MAVS [R537A, R538A] C-terminal tmd targeting information (Mitochondria and ER insertion)DepositorInsertEGFP-uTEV1-MAVS(tmd)[R537A, R538A]
UseLentiviral and Synthetic BiologyExpressionMammalianMutationMAVS(tmd)[R537A, R538A]PromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-MAVS-mTA3
Plasmid#171001PurposeHiLITR protease with MAVS [Y536delinsFIV] C-terminal tmd targeting information (Mitochondria and ER insertion)DepositorInsertEGFP-uTEV1-MAVS(tmd)[Y536delinsFIV]
UseLentiviral and Synthetic BiologyExpressionMammalianMutationMAVS(tmd)[Y536delinsFIV]PromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-MAVS-mTA5
Plasmid#171003PurposeHiLITR protease with MAVS [Y536delinsFIVLI, R537A] C-terminal tmd targeting information (Mitochondria and ER insertion)DepositorInsertEGFP-uTEV1-MAVS(tmd)[Y536delinsFIVLI, R537A]
UseLentiviral and Synthetic BiologyExpressionMammalianMutationMAVS(tmd)[Y536delinsFIVLI, R537A]PromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
HeFm1SpCas9
Plasmid#92110PurposeExpression plasmid for human codon-optimized increased fidelity HeFm1SpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity mut1 Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationR661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCbhAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
SMR3B-bio-His
Plasmid#52183PurposeExpresses full-length Submaxillary gland androgen-regulated protein 3B precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertSMR3B (SMR3B Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
BL21(DE3)-R3-pRARE2
Bacterial Strain#26242PurposePhage-resistant derivative of BL21(DE3), which has been transformed with plasmid pRARE2, which carries seven rare-codon tRNA genes.DepositorBacterial ResistanceChloramphenicolAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only