We narrowed to 5,412 results for: U6
-
Plasmid#61479PurposeEncodes CRISPR sgRNA for Gateway or conventional cloning of 1-3 sgRNAs into pDe-CAS9 or pCAS9-TPCDepositorInsertAtU6-26:sgRNA
UseCRISPRExpressionPlantPromoterU6-26Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shGAC
Plasmid#110410PurposeshGAC (Target CCTCTGTTCTGTCAGAGTT), silence glutaminase isoform GAC, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_314
Plasmid#111822PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 294-314
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
p184_LTJ_sgRNACD90.2
Plasmid#82670PurposesgRNA targeting murine CD90.2. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting mouse CD90.2
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Ago2_1
Plasmid#73529PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Ago2DepositorInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Ago2_2
Plasmid#73530PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Ago2DepositorInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
CEP55 B12.2 gRNA
Plasmid#90623Purpose3rd generation lentiviral gRNA plasmid targeting human CEP55DepositorInsertCEP55 (Guide Designation B12.2)
UseCRISPR and LentiviralPromoterU6Available SinceNov. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + FANCM sgSTOP
Plasmid#100710PurposeB52 plasmid expressing FANCM sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting FANCM (cloned using BbsI) (FANCM Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + CHEK2 sgSTOP
Plasmid#100712PurposeB52 plasmid expressing CHEK2 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting CHEK2 (cloned using BbsI) (CHEK2 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
FOXM1 C11.2 gRNA
Plasmid#90690Purpose3rd generation lentiviral gRNA plasmid targeting human FOXM1DepositorInsertFOXM1 (Guide Designation C11.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
ANLN A2.2 gRNA
Plasmid#90531Purpose3rd generation lentiviral gRNA plasmid targeting human ANLNDepositorInsertANLN (Guide Designation A2.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F1.3 gRNA
Plasmid#90652Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CEP55 B11.2 gRNA
Plasmid#90622Purpose3rd generation lentiviral gRNA plasmid targeting human CEP55DepositorInsertCEP55 (Guide Designation B11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
FEN1 C10.3 gRNA
Plasmid#90689Purpose3rd generation lentiviral gRNA plasmid targeting human FEN1DepositorInsertFEN1 (Guide Designation C10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
VCP F12.4 gRNA
Plasmid#90939Purpose3rd generation lentiviral gRNA plasmid targeting human VCPDepositorInsertVCP (Guide Designation F12.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
VCP F11.4 gRNA
Plasmid#90938Purpose3rd generation lentiviral gRNA plasmid targeting human VCPDepositorInsertVCP (Guide Designation F11.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBSU6-shTim23/CMV-eGFP
Plasmid#89795PurposeExpresses shRNA against TIM23 with a separate promoter for expression of GFP.DepositorInsertshRNA Tim23 (Timm23 Mouse)
TagseGFP under separate promoterExpressionMammalianPromoterU6Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only