We narrowed to 12,047 results for: shRNA
-
Plasmid#218654PurposeKnockout vector for mouse Fam160b1 (Fhip2A)DepositorAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only
-
msFam160b1 (msFHIP2A) g2 lentiCRISPRv2 mCherry
Plasmid#218655PurposeKnockout vector for mouse Fam160b1 (Fhip2A)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g2 LentiCRISPRv2-mCherry
Plasmid#218663PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g1 LentiCRISPRv2-mCherry
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL661-TTTA
Plasmid#215865PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL661 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-EGFP12-TTTA
Plasmid#215857PurposeThis plasmid encodes sgRNA that target EGFP with stretch sequenceDepositorInsertsgRNA-EGFP12 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL714-TTTA
Plasmid#215867PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL714 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL864-TTTA
Plasmid#215859PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL864 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL864R-TTTA
Plasmid#215861PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL864R with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL554-TTTA
Plasmid#215863PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL554 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB11785
Plasmid#212699PurposegRNA targeting to the intergradtion site E4DepositorInsertgRNA targeting to the intergradtion site E4
ExpressionYeastAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB10769
Plasmid#212694PurposegRNA targeting to the intergradtion site E2DepositorInsertgRNA targeting to the intergradtion site E2
ExpressionYeastAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFP-2A-Puro-gATRIP_A
Plasmid#211537PurposesgRNA-A against ATRIPDepositorInsertsgRNA ATRIP
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB12719
Plasmid#212702PurposegRNA targeting to the intergradtion site F3DepositorInsertgRNA targeting to the intergradtion site F3
ExpressionYeastAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB12720
Plasmid#212704PurposegRNA targeting to the gene 4HPPD locusDepositorInsertgRNA targeting to the gene 4HPPD locus
ExpressionYeastAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB11787
Plasmid#212695PurposegRNA targeting to the intergradtion site E2DepositorInsertgRNA targeting to the intergradtion site E2
ExpressionYeastAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB6637
Plasmid#212696PurposegRNA targeting to the intergradtion site E3DepositorInsertgRNA targeting to the intergradtion site E3
ExpressionYeastAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB8860
Plasmid#212697PurposegRNA targeting to the intergradtion site E3DepositorInsertgRNA targeting to the intergradtion site E3
ExpressionYeastAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB8856
Plasmid#212701PurposegRNA targeting to the intergradtion site C3DepositorInsertgRNA targeting to the intergradtion site C3
ExpressionYeastAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only